For general questions please contact our Customer Service:
Merck KGaA
Frankfurter Str. 250
64293 Darmstadt
Germany
Phone: +49 6151 72-0
Fax: +49 6151 72 2000
01 June 2012
loading
| Related products | |
|---|---|
| 70005 | T7SelectUP Primer |
| Related products for T7SelectDOWN Primer | |
| 70005 | T7SelectUP Primer |
| Product information | |||
|---|---|---|---|
| Avoid freeze/thaw | Yes | ||
| Oligo seqence | 5′ - AACCCCTCAAGACCCGTTTA - 3′ | ||
| Store and ship information | |||
|---|---|---|---|
| Storage | -20°C | ||
| Ship |
Shipped with Blue Ice or with Dry Ice
Standard Handling |
||





