Information
X


70005  T7SelectUP Primer

For general questions please contact our Customer Service:

Merck KGaA
Frankfurter Str. 250
64293 Darmstadt
Germany
Phone: +49 6151 72-0
Fax: +49 6151 72 2000

Contact us


01 June 2012

loading
 
Product number Qty/Pk Quantity Price
70005-3  500 pmol  loading
Prices are subject to change without notice.
T7Select Vector primers are convenient for amplification and sequencing of T7Select recombinants, and are compatible with all T7Select vectors. Mr: 6105
Related products
70006 T7SelectDOWN Primer
Product information
Avoid freeze/thaw Yes
Oligo seqence 5′ - GGAGCTGTCGTATTCCAGTC - 3′
Store and ship information
Storage -20°C
Ship Shipped with Blue Ice or with Dry Ice
Standard Handling

© Merck KGaA, Darmstadt, Germany, 2012


x

Welcome to Merck Millipore

 

Europe, Middle East and Africa Asia / Pacific North America, Central America and the Caribbean South America

Please choose your country:

North America, Central America and the Caribbean

South America

Europe, Middle East and Africa

Asia / Pacific

All countries from A to Z

If you can't find your country please click here.

 

x

Merck Chemicals Cart ()

You are entering the Millipore online shop. Both carts are maintained for you while you shop between sites. We recommend to complete your Merck order before visiting Millipore.com.

Go to Millipore Proceed to checkout


What kind of products are you looking for?

Millipore

Bio manufacturing and Life science.

Merck Chemicals

High-quality industrial and laboratory chemicals.


Important message


It is currently not possible to order Bioscience products together with other Merck products. We recommend completing your current order first.

Do you wish to proceed without completing your current order? If so, this will empty your shopping cart.