Information
X


70847  TriEx™DOWN Primer

Convenient sequencing and amplification of recombinant vectors

Wenn Sie allgemeine Fragen haben, wenden Sie sich bitte an unseren Kundenservice:

Merck KGaA
Frankfurter Str. 250
64293 Darmstadt
Germany
Telefon: +49 6151 72-0
Fax: +49 6151 72 2000

Kontaktieren Sie uns.


01 Juni 2012

wird geladen
 
Bestellnummer St./Pkg. Menge Preis
70847-3  500 pmol  wird geladen
Preisänderungen vorbehalten.
All TriEx™UP vector primers have been application-tested and are supplied ready to use at the working concentration (5 pmol/µl). Each vial contains a total of 500 pmol (100 µl) of oligonucleotide. Mr: 6438
Verwandte Produkte
70846 TriEx™UP Primer
Produktinformationen
Oligo seqence TriEx™DOWN Primer 5' - TCGATCTCAGTGGTATTTGTG - 3'
Lager- und Versandinformationen
Lagerkategorie -20°C
Ship Shipped with Blue Ice or with Dry Ice
Standard Handling

© Merck KGaA, Darmstadt, Deutschland, 2012


x

Willkommen bei Merck Millipore

 

Europa, Mittlerer Osten und Afrika Asien / Pazifik Nordamerika, Zentralamerika und die Karibik Südamerika

Bitte wählen Sie ihr Land:

Nordamerika, Zentralamerika und die Karibik

Südamerika

Europa, Mittlerer Osten und Afrika

Asien / Pazifik

Alle Länder von A bis Z

Wenn Sie Ihr Land nicht finden können, klicken Sie bitte hier.

 

x

Merck Chemicals Cart ()

You are entering the Millipore online shop. Both carts are maintained for you while you shop between sites. We recommend to complete your Merck order before visiting Millipore.com.

Go to Millipore Proceed to checkout


What kind of products are you looking for?

Millipore

Bio manufacturing and Life science.

Merck Chemicals

High-quality industrial and laboratory chemicals.


Wichtige Mitteilung


Es ist derzeit nicht möglich, Bioscience-Produkte zusammen mit anderen Merck-Produkten zu bestellen. Wir empfehlen, erst Ihren aktuellen Auftrag abzuschließen.

Möchten Sie fortfahren, ohne Ihren aktuellen Auftrag abzuschließen? Falls ja, wird Ihr Warenkorb gelöscht.