70006 Sigma-AldrichT7SelectDOWN Primer
Recommended Products
Overview
| Replacement Information |
|---|
Pricing & Availability
| Catalogue Number | Availability | Packaging | Qty/Pack | Price | Quantity | |
|---|---|---|---|---|---|---|
| 70006-3 |
|
Plastic ampoule | 500 pmol |
|
— |
| References |
|---|
| Product Information | |
|---|---|
| Oligo seqence | 5ʹ - AACCCCTCAAGACCCGTTTA - 3ʹ |
| Quality Level | MQ100 |
| Applications |
|---|
| Biological Information |
|---|
| Physicochemical Information |
|---|
| Dimensions |
|---|
| Materials Information |
|---|
| Toxicological Information |
|---|
| Safety Information according to GHS |
|---|
| Safety Information |
|---|
| Product Usage Statements |
|---|
| Storage and Shipping Information | |
|---|---|
| Ship Code | Shipped with Blue Ice or with Dry Ice |
| Toxicity | Standard Handling |
| Storage | -20°C |
| Avoid freeze/thaw | Avoid freeze/thaw |
| Do not freeze | Ok to freeze |
| Packaging Information |
|---|
| Transport Information |
|---|
| Supplemental Information |
|---|
| Specifications |
|---|
| Global Trade Item Number | |
|---|---|
| Catalogue Number | GTIN |
| 70006-3 | 04055977273854 |
Documentation
T7SelectDOWN Primer SDS
| Title |
|---|
T7SelectDOWN Primer Certificates of Analysis
| Title | Lot Number |
|---|---|
| 70006 |
Citations
| Title | |
|---|---|
|
|


