Skip to Content
Merck

EHU019931

MISSION® esiRNA

targeting human KIF11

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCCCGTAACAAGAGAGGAGTGATAATTAAAGGTTTAGAAGAAATTACAGTACACAACAAGGATGAAGTCTATCAAATTTTAGAAAAGGGGGCAGCAAAAAGGACAACTGCAGCTACTCTGATGAATGCATACTCTAGTCGTTCCCACTCAGTTTTCTCTGTTACAATACATATGAAAGAAACTACGATTGATGGAGAAGAGCTTGTTAAAATCGGAAAGTTGAACTTGGTTGATCTTGCAGGAAGTGAAAACATTGGCCGTTCTGGAGCTGTTGATAAGAGAGCTCGGGAAGCTGGAAATATAAATCAATCCCTGTTGACTTTGGGAAGGGTCATTACTGCCCTTGTAGAAAGAACACCTCATGTTCCTTATCGAGAATCTAAACTAACTAGAATCCTCCAGGATTCTCTTGGAGGGCGTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KIF11(3832)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library


Articles

esiRNA are endoribonuclease prepared siRNAs that target the same mRNA sequence for gene silencing. Here are some of the most asked questions regarding esiRNA uses and availability.

Related Content

Instructions


Takeharu Imai et al.
Anticancer research, 37(1), 47-55 (2016-12-25)
Oesophageal squamous cell carcinoma (ESCC) and colorectal cancer (CRC) are common types of human cancer. Spheroid colony formation is used to characterize cancer stem cell (CSCs). In the present study, we analyzed the significance of kinesin family 11 (KIF11 in
Kai Zhu et al.
American journal of translational research, 11(4), 2245-2256 (2019-05-21)
Micro RNA (miRNAs) is a kind of non coding small RNAs with negative regulation function, which plays an important role in regulating the occurrence and development of tumors. In this study, we analyzed the expression level and role of miRNA-186-5p
Wei Zhang et al.
Advanced healthcare materials, 5(12), 1493-1504 (2016-04-26)
Developing RNA-interference-based therapeutic approaches with efficient and targeted cytosolic delivery of small interfering RNA (siRNA) is remaining a critical challenge since two decades. Herein, a multifunctional transferrin receptor (TfR)-targeted siRNA delivery system (Tf&INF7) is designed based on siRNA complexes formed