Skip to Content
Merck

EHU005441

MISSION® esiRNA

targeting human FLT1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGTCTTTGCCTGAAATGGTGAGTAAGGAAAGCGAAAGGCTGAGCATAACTAAATCTGCCTGTGGAAGAAATGGCAAACAATTCTGCAGTACTTTAACCTTGAACACAGCTCAAGCAAACCACACTGGCTTCTACAGCTGCAAATATCTAGCTGTACCTACTTCAAAGAAGAAGGAAACAGAATCTGCAATCTATATATTTATTAGTGATACAGGTAGACCTTTCGTAGAGATGTACAGTGAAATCCCCGAAATTATACACATGACTGAAGGAAGGGAGCTCGTCATTCCCTGCCGGGTTACGTCACCTAACATCACTGTTACTTTAAAAAAGTTTCCACTTGACACTTTGATCCCTGATGGAAAACGCATAATCTGGGACAGTAGAAAGGGCTTCATCATATCAAATGCAACGTACAAAGAAATAGGGCTTCTGACCTGTGAAGCAACAGTCAATGGGCATTTGTATAAGACAAACTATCTCACACATCGACAAACCAATACAATCATAGATGTCCAAATAAGCACACCACGCCCAGTCAAATTAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FLT1(2321)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library


Related Content

Instructions


Jun Yu et al.
Placenta, 58, 1-8 (2017-10-01)
Excessive circulating sFlt1 plays a major role in the pathogenesis of preeclampsia (PE). Using RNAi to silence sFlt1 may be a therapy for treating PE. Because of the rapid degradation of siRNA, gene therapy in vivo remains limited. Poly-amidoamine (PAMAM) has
Ramcharan Singh Angom et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 4626-4637 (2018-12-24)
Aggregated amyloid β (Aβ) peptides in the Alzheimer's disease (AD) brain are hypothesized to trigger several downstream pathologies, including cerebrovascular dysfunction. Previous studies have shown that Aβ peptides can have antiangiogenic properties, which may contribute to vascular dysfunction in the
Jaewoo Hong et al.
Cancers, 12(6) (2020-05-31)
The vascular response to hypoxia and ischemia is essential for maintaining homeostasis during stressful conditions and is particularly critical for vital organs such as the heart. Hypoxia-inducible factor-1 (HIF-1) is a central regulator of the response to hypoxia by activating