Skip to Content
Merck

EHU010021

MISSION® esiRNA

targeting human GATA2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTACCTGTGCAATGCCTGTGGCCTCTACCACAAGATGAATGGGCAGAACCGACCACTCATCAAGCCCAAGCGAAGACTGTCGGCCGCCAGAAGAGCCGGCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGAAACGCCAACGGGGACCCTGTCTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACTCGGAACCGGAAGATGTCCAACAAGTCCAAGAAGAGCAAGAAAGGGGCGGAGTGCTTCGAGGAGCTGTCAAAGTGCATGCAGGAGAAGTCATCCCCCTTCAGTGCAGCTGCCCTGGCTGGACACATGGCACCTGTGGGCCACCTCCCGCCCTTCAGCCACTCCGGACACATCCTGCCCACTCCGACGCCCATCCACCCCTCCTCCAGCCTCTCCTTCGGCCACCCCCACCCGTCCAGCATGGTGACCGCCATGGGCTAGGGAACAGATGGACGTCGAGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Carole-Anne Whigham et al.
Scientific reports, 9(1), 235-235 (2019-01-20)
Preeclampsia is a pregnancy complication associated with elevated placental secretion of anti-angiogenic factors, maternal endothelial dysfunction and organ injury. GATA2 is a transcription factor expressed in the endothelium which regulates vascular homeostasis by controlling transcription of genes and microRNAs, including
Yujie Fu et al.
Scientific reports, 10(1), 9027-9027 (2020-06-05)
Encouraging clinical results using immune checkpoint therapies to target the PD-1 axis in a variety of cancer types have paved the way for new immune therapy trials in brain tumor patients. However, the molecular mechanisms that regulate expression of the
Siyan Chen et al.
Molecular immunology, 123, 32-39 (2020-05-16)
At present, most studies on the relationship between hepatitis B virus (HBV) and IL-33/ST2 axis focus on clinical detection, but the underlying molecular mechanisms of HBx and IL-33/ST2 axis regulation and Th cell function regulation have not been explored. In
Cai-Xia Wang et al.
American journal of translational research, 12(7), 3557-3576 (2020-08-11)
Tumor endothelial cell marker 8 (TEM8) is a type I transmembrane protein, that has been widely studied in the areas of anthrax toxin infection and tumor angiogenesis. However, the role of TEM8 in the progression of epithelial ovarian cancer (EOC)
Cong Qiu et al.
Nature communications, 8, 15426-15426 (2017-06-02)
Data from clinical research and our previous study have suggested the potential involvement of SENP1, the major protease of post-translational SUMOylation, in cardiovascular disorders. Here, we investigate the role of SENP1-mediated SUMOylation in graft arteriosclerosis (GA), the major cause of

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service