Skip to Content
Merck

EHU013431

MISSION® esiRNA

targeting human RAD18

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCAGGGGAGCAGGTTAATGGATAATTTCTTGATCAGAGAAATGAGTGGTTCTACATCAGAGTTGTTGATAAAAGAAAATAAAAGCAAATTCAGCCCTCAAAAAGAGGCGAGCCCTGCTGCAAAGACCAAAGAGACACGTTCTGTAGAAGAGATCGCTCCAGATCCCTCAGAGGCTAAGCGTCCTGAGCCACCCTCGACATCCACTTTGAAACAAGTTACTAAAGTGGATTGTCCTGTTTGCGGGGTTAACATTCCAGAAAGTCACATTAATAAGCATTTAGACAGCTGTTTATCACGCGAAGAGAAGAAGGAAAGCCTCAGAAGTTCTGTTCACAAAAGGAAGCCGCTGCCCAAAACTGTATATAATTTGCTCTCTGATCGTGATTTAAAGAAAAAGCTAAAAGAGCATGGATTATCTATTCAAGGAAATAAACAACAGCTCATTAAAAGGCACCAAGAATTTGTACACATGTACAATGCCCAATGCGATGCTTTGCATCCTAAATCAGCTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAD18(56852)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library


Related Content

Instructions


Megumi Sasatani et al.
PloS one, 10(2), e0117845-e0117845 (2015-02-13)
The ubiquitin ligase RAD18 is involved in post replication repair pathways via its recruitment to stalled replication forks, and its role in the ubiquitylation of proliferating cell nuclear antigen (PCNA). Recently, it has been reported that RAD18 is also recruited
Chen Xie et al.
Journal of cellular physiology, 234(11), 21100-21112 (2019-05-14)
This study aimed at investigating the role of RAD18 in the regulation of glioblastoma development as well as the underlying mechanisms. The human glioblastoma U251 and U87MG cells were transfected with siRNAs specifically targeting RAD18, and the effects of knockdown
Thomas Göhler et al.
The Journal of cell biology, 192(2), 219-227 (2011-01-19)
DNA polymerase η (polη) belongs to the Y-family of DNA polymerases and facilitates translesion synthesis past UV damage. We show that, after UV irradiation, polη becomes phosphorylated at Ser601 by the ataxia-telangiectasia mutated and Rad3-related (ATR) kinase. DNA damage-induced phosphorylation