Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCTGGTGCTCTTCTTCATCCCCATGGCAGTCACCATCTTCTGCTACTGGCGTTTTGTGTGGATCATGCTCTCCCAGCCCCTTGTGGGGGCCCAGAGGCGGCGCCGAGCCGTGGGGCTGGCTGTGGTGACGCTGCTCAATTTCCTGGTGTGCTTCGGACCTTACAACGTGTCCCACCTGGTGGGGTATCACCAGAGAAAAAGCCCCTGGTGGCGGTCAATAGCCGTGGTGTTCAGTTCACTCAACGCCAGTCTGGACCCCCTGCTCTTCTATTTCTCTTCTTCAGTGGTGCGCAGGGCATTTGGGAGAGGGCTGCAGGTGCTGCGGAATCAGGGCTCCTCCCTGTTGGGACGCAGAGGCAAAGACACAGCAGAGGGGACAAATGAGGACAGGGGTGTGGGTCAAGGAGAAGGGATGCCAAGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FFAR2(2867)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Rebecca Roy et al.
Journal of molecular endocrinology, 65(2), 21-34 (2020-06-25)
Gestational diabetes mellitus (GDM) affects up to 16% of pregnant women and is associated with significant long-term health detriments for the mother and her offspring. Two central features of GDM are low-grade inflammation and maternal peripheral insulin resistance, therefore therapeutics
Laure B Bindels et al.
British journal of cancer, 117(9), 1336-1340 (2017-09-06)
Activation of free fatty acid receptor 2 (FFAR2) by microbiota-derived metabolites (e.g., propionate) reduces leukaemic cell proliferation in vitro. This study aims to test whether Ffar2 expression per se also influences leukaemia cell growth in vivo. Bcr-Abl-expressing BaF cells were
Hiroki Yoshida et al.
Archives of biochemistry and biophysics, 672, 108057-108057 (2019-07-30)
Short-chain fatty acids (SCFAs) such as acetate, propionate, and butyrate are generated by gut microbial fermentation of dietary fiber. SCFAs may exert multiple beneficial effects on human lipid and glucose metabolism. However, their actions and underlying mechanisms are not fully