Skip to Content
Merck

EHU051241

MISSION® esiRNA

targeting human HMOX1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGACACCAAGGACCAGAGCCCCTCACGGGCACCAGGGCTTCGCCAGCGGGCCAGCAACAAAGTGCAAGATTCTGCCCCCGTGGAGACTCCCAGAGGGAAGCCCCCACTCAACACCCGCTCCCAGGCTCCGCTTCTCCGATGGGTCCTTACACTCAGCTTTCTGGTGGCGACAGTTGCTGTAGGGCTTTATGCCATGTGAATGCAGGCATGCTGGCTCCCAGGGCCATGAACTTTGTCCGGTGGAAGGCCTTCTTTCTAGAGAGGGAATTCTCTTGGCTGGCTTCCTTACCGTGGGCACTGAAGGCTTTCAGGGCCTCCAGCCCTCTCACTGTGTCCCTCTCTCTGGAAAGGAGGAAGGAGCCTATGGCATCTTCCCCAACGAAAAGCACATCCAGGCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HMOX1(3162)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fiona C Brownfoot et al.
EBioMedicine, 41, 636-648 (2019-03-03)
Preeclampsia is a major complication of pregnancy with no medical treatment. It is associated with placental oxidative stress, hypoxia and inflammation leading to soluble fms-like tyrosine kinase 1 (sFlt-1) and soluble endoglin (sENG) secretion and reduced placental growth factor (PlGF).
Chaoying Zhu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(2), 644-653 (2018-04-05)
Nucleus pulposus cell (NPC) apoptosis is the main factor in intervertebral disc degeneration (IDD); thus, inhibiting the excessive apoptosis of nucleus pulposus cells may be a potential way to alleviate IDD. The effect of Hemeoxygenase-1 (HO-1) on human NPC apoptosis
Yunjun Xiao et al.
Oxidative medicine and cellular longevity, 2018, 3295807-3295807 (2018-10-18)
Curcumin has several therapeutic properties such as anti-inflammatory effect. Heme oxygenase-1 (HO-1) has been showed to have cytoprotective effects in some pathological conditions. However, the role of HO-1 in anti-inflammatory effect of curcumin is unknown. In this study, we investigate
Kritika Sudan et al.
Free radical biology & medicine, 137, 131-142 (2019-04-27)
Heme oxygenase (HO)-1, a stress-inducible enzyme that converts heme into carbon monoxide (CO), iron and biliverdin, exerts important anti-inflammatory effects in activated macrophages. HO-1 expression is mainly governed by a mutual interplay between the transcriptional factor NRF2 and the nuclear
Hongyan Lu et al.
Frontiers in cell and developmental biology, 8, 584653-584653 (2020-10-27)
We have shown previously that adipose stromal cell (ASC)-derived conditioned media (CM) limited lung injury, endothelial barrier dysfunction, and apoptosis. Here, we used endothelial hyperpermeability and apoptosis assays to investigate how concentration processes affect endothelium-directed bioactivity of ASC-CM and to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service