Skip to Content
Merck

EHU076591

MISSION® esiRNA

targeting human ROBO1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATGGAGTCCTCGTTTCAACCCAAGACTCTCGAATCAAACAGTTGGAGAATGGAGTACTGCAGATCCGATATGCTAAGCTGGGTGATACTGGTCGGTACACCTGCATTGCATCAACCCCCAGTGGTGAAGCAACATGGAGTGCTTACATTGAAGTTCAAGAATTTGGAGTTCCAGTTCAGCCTCCAAGACCTACTGACCCAAATTTAATCCCTAGTGCCCCATCAAAACCTGAAGTGACAGATGTCAGCAGAAATACAGTCACATTATCGTGGCAACCAAATTTGAATTCAGGAGCAACTCCAACATCTTATATTATAGAAGCCTTCAGCCATGCATCTGGTAGCAGCTGGCAGACCGTAGCAGAGAATGTGAAAACAGAAACATCTGCCATTAAAGGACTCAAACCTAATGCAATTTACCTTTTCCTTGTGAGGGCAGCTAAT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ROBO1(6091)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Zongpu Zhang et al.
Aging, 13(4), 5055-5068 (2021-02-04)
Vasculogenic mimicry (VM), the formation of an alternative microvascular circulation independent of VEGF-driven angiogenesis, is reluctant to anti-angiogenesis therapy for glioma patients. However, treatments targeting VM are lacking due to the poor understanding of the molecular mechanism involved in VM
Gael Genet et al.
Nature communications, 10(1), 2350-2350 (2019-05-30)
Endothelial cell migration, proliferation and survival are triggered by VEGF-A activation of VEGFR2. However, how these cell behaviors are regulated individually is still unknown. Here we identify Endophilin-A2 (ENDOA2), a BAR-domain protein that orchestrates CLATHRIN-independent internalization, as a critical mediator
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4