Skip to Content
Merck

EHU106031

MISSION® esiRNA

targeting human CDC20

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTACAGCCAAAAGGCCACTCCTGGCTCCAGCCGGAAGACCTGCCGTTACATTCCTTCCCTGCCAGACCGTATCCTGGATGCGCCTGAAATCCGAAATGACTATTACCTGAACCTTGTGGATTGGAGTTCTGGGAATGTACTGGCCGTGGCACTGGACAACAGTGTGTACCTGTGGAGTGCAAGCTCTGGTGACATCCTGCAGCTTTTGCAAATGGAGCAGCCTGGGGAATATATATCCTCTGTGGCCTGGATCAAAGAGGGCAACTACTTGGCTGTGGGCACCAGCAGTGCTGAGGTGCAGCTATGGGATGTGCAGCAGCAGAAACGGCTTCGAAATATGACCAGTCACTCTGCCCGAGTGGGCTCCCTAAGCTGGAACAGCTATATCCTGTCCAGTGGTTCACGTTCTGGCCACATCCACCACCATGATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDC20(991)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yuan Gao et al.
Aging, 13(2), 2668-2680 (2021-01-08)
The molecular mechanism of osteosarcoma (OS) pathogenesis is poorly understood. The Notch signaling pathway has been shown to be critically involved in tumorigenesis, including OS. Therefore, we explored the molecular mechanism by which the Notch-1 signaling pathway is involved in
Shujie Cheng et al.
International journal of oncology, 54(6), 2250-2256 (2019-05-14)
Aberrant expression of cell division cycle 20 (CDC20) is associated with malignant progression and poor prognosis in various types of cancer. The development of specific CDC20 inhibitors may be a novel strategy for the treatment of cancer with elevated expression of
Jia Li et al.
International journal of oncology, 45(4), 1547-1555 (2014-07-30)
Cell division cycle 20 (CDC20) encodes a regulatory protein interacting with the anaphase-promoting complex/cyclosome (APC/C) in the cell cycle and plays important roles in tumorigenesis and progression of multiple tumors. The present study aimed to investigate the clinical significance of