Skip to Content
Merck

EHU106761

MISSION® esiRNA

targeting human STUB1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAATCTGCAGCGAGCTTACAGCCTGGCCAAGGAGCAGCGGCTGAACTTCGGGGACGACATCCCCAGCGCTCTTCGAATCGCGAAGAAGAAGCGCTGGAACAGCATTGAGGAGCGGCGCATCCACCAGGAGAGCGAGCTGCACTCCTACCTCTCCAGGCTCATTGCCGCGGAGCGTGAGAGGGAGCTGGAAGAGTGCCAGCGAAACCACGAGGGTGATGAGGACGACAGCCACGTCCGGGCCCAGCAGGCCTGCATTGAGGCCAAGCACGACAAGTACATGGCGGACATGGACGAGCTTTTTTCTCAGGTGGATGAGAAGAGGAAGAAGCGAGACATCCCCGACTACCTGTGTGGCAAGATCAGCTTTGAGCTGATGCGGGAGCCGTGCATCACGCCCAGTGGCATCACCTACGACCGCAAGGACATCGAGGAGCACCTGCAGCGTGTGGGTCATTTTGACCCCGTGACCCGGAGCCCCCTGACCCAGGAACAGCTCATCCCCAACTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... STUB1(10273)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Qasim A Khan et al.
PloS one, 13(7), e0199699-e0199699 (2018-07-07)
ALDH1L1 is a folate-metabolizing enzyme abundant in liver and several other tissues. In human cancers and cell lines derived from malignant tumors, the ALDH1L1 gene is commonly silenced through the promoter methylation. It was suggested that ALDH1L1 limits proliferation capacity
Jian Wang et al.
Oncotarget, 7(49), 81377-81388 (2016-11-12)
The androgen receptor (AR) is not only a ligand-dependent transcription factor, but also functions as a licensing factor, a component of DNA replication, which is degraded during mitosis. Furthermore, the deregulation of AR activity is involved in the initiation of
Pengfei Zhang et al.
Cell death and differentiation, 27(11), 3177-3195 (2020-06-03)
Ovarian tumour domain-containing protein 3 (OTUD3), a key OTU (ovarian tumour protease) family deubiquitylase, plays context-dependent roles in cancers. It suppresses tumorigenesis in breast, colon, liver and cervical cancer through stabilizing PTEN (phosphatase and tension homologue deleted on chromosome 10)