Skip to Content
Merck

EHU123831

MISSION® esiRNA

targeting human DNMT3A

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAATGACCTCTCCATCGTCAACCCTGCTCGCAAGGGCCTCTACGAGGGCACTGGCCGGCTCTTCTTTGAGTTCTACCGCCTCCTGCATGATGCGCGGCCCAAGGAGGGAGATGATCGCCCCTTCTTCTGGCTCTTTGAGAATGTGGTGGCCATGGGCGTTAGTGACAAGAGGGACATCTCGCGATTTCTCGAGTCCAACCCTGTGATGATTGATGCCAAAGAAGTGTCAGCTGCACACAGGGCCCGCTACTTCTGGGGTAACCTTCCCGGTATGAACAGGCCGTTGGCATCCACTGTGAATGATAAGCTGGAGCTGCAGGAGTGTCTGGAGCATGGCAGGATAGCCAAGTTCAGCAAAGTGAGGACCATTACTACGAGGTCAAACTCCATAAAGCAGGGCAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DNMT3A(1788)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yu Nomura et al.
Cells, tissues, organs, 207(3-4), 115-126 (2019-10-02)
Stem cells have essential applications in in vitro tissue engineering or regenerative medicine. However, there is still a need to understand more deeply the mechanisms of stem cell differentiation and to optimize the methods to control stem cell function. In
Xi Han et al.
Cell biology international, 45(1), 227-237 (2020-10-23)
Emerging evidence suggests that miR-143 plays an important role in the regulation of tumor sensitivity to chemotherapeutic agents. The study explores the underlying mechanism of miR-143 in reversing cisplatin resistance in ovarian cancer. The cisplatin-resistant ovarian cancer cell line A2780/CDDP
Phillip L Palmbos et al.
Cancer research, 75(23), 5155-5166 (2015-10-17)
Bladder cancer is a common and deadly malignancy but its treatment has advanced little due to poor understanding of the factors and pathways that promote disease. ATDC/TRIM29 is a highly expressed gene in several lethal tumor types, including bladder tumors