Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTTGTTAGAGGGCCCAGAGTTCCTTCTCCACCCCCGCTCTCTCTCTCTTGGCCTGAGATCTCTGTGCAGGAACCAAGATGGGGCTGAAGCCTCTGGAGGCAGTTGGTTGGGGGCGGGCAGGCAGGAGGCCCTCCCTCCACCCCCCCACCCTCAGCCCGGCAACTTCTGGGTTCCATGGGTTTTAGTTCCGTTCTCGTTTTCTTCCTCCGTTATTGATTTCTCCTTTCTCCCTAAGCCCCCTTCTGCTTCCACGCCCTTTTCCTCTTTGAAGAGTCAAGTACAATTCAGACAAACTGCTTTCTCCTGTCCAAAAGCAAAAAGGCAAAGGAAAGAAAGAAAGCTTCAGACCGCTAGTAAGGCTCAAAGAAGAAGAAAAACACCAAAACCACAAGGGAAAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... UNC5B(219699)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Zongyi Xie et al.
Brain, behavior, and immunity, 69, 190-202 (2017-11-23)
Neuroinflammation is an essential mechanism involved in the pathogenesis of subarachnoid hemorrhage (SAH)-induced brain injury. Recently, Netrin-1 (NTN-1) is well established to exert anti-inflammatory property in non-nervous system diseases through inhibiting infiltration of neutrophil. The present study was designed to
Junhui Chen et al.
Journal of cellular and molecular medicine, 23(3), 2256-2262 (2019-01-08)
Netrin-1 (NTN-1) is a novel drug to alleviate early brain injury following subarachnoid haemorrhage (SAH). However the molecular mechanism of NTN-1-mediated protection against early brain injury following SAH remains largely elusive. This study aims to evaluate the effects and mechanisms
Bo Wang et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(5), 939-954 (2019-01-16)
Normal bone mass is maintained by balanced bone formation and resorption. Myosin X (Myo10), an unconventional "myosin tail homology 4-band 4.1, ezrin, radixin, moesin" (MyTH4-FERM) domain containing myosin, is implicated in regulating osteoclast (OC) adhesion, podosome positioning, and differentiation in