Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTGGACCATGAAGACCAGATTGCTTTGCTGAAAGGGTCTGCGGTTGAAGCTATGTTCCTTCGTTCAGCTGAGATTTTCAATAAGAAACTTCCGTCTGGGCATTCTGACCTATTGGAAGAAAGAATTCGAAATAGTGGTATCTCTGATGAATATATAACACCTATGTTTAGTTTTTATAAAAGTATTGGGGAACTGAAAATGACTCAAGAGGAGTATGCTCTGCTTACAGCAATTGTTATCCTGTCTCCAGATAGACAATACATAAAGGATAGAGAGGCAGTAGAGAAGCTTCAGGAGCCACTTCTTGATGTGCTACAAAAGTTGTGTAAGATTCACCAGCCTGAAAATCCTCAACACTTTGCCTGTCTCCTGGGTCGCCTGACTGAATTACGGACATTCAATCATCACCACGCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NR1H4(9971)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wenxuan Xu et al.
Toxicology and applied pharmacology, 315, 23-34 (2016-12-13)
Alcoholic liver disease (ALD) is a common etiology of liver diseases, characterized by hepatic steatosis. We previously identified farnesoid X receptor (FXR) as a potential therapeutic target for ALD. Dihydroartemisinin (DHA) has been recently identified to possess potent pharmacological activities
Dihydroartemisinin restricts hepatic stellate cell contraction via an FXR-S1PR2-dependent mechanism.
Wenxuan Xu et al.
IUBMB life, 68(5), 376-387 (2016-03-31)
Hepatic stellate cells (HSCs) are universally acknowledged to play a stimulative role in the pathogenesis of hepatic fibrosis and portal hypertension. HSCs when activated in response to liver injury are characterized with many changes, with HSC contraction being the most
Ting Fu et al.
Molecular endocrinology (Baltimore, Md.), 30(1), 92-103 (2015-10-28)
The bile acid (BA)-sensing nuclear receptor, farnesoid X receptor (FXR), regulates postprandial metabolic responses, including inhibition of BA synthesis, by inducing the intestinal hormone, fibroblast growth factor (FGF)15 (FGF19 in human). In this study, we tested a novel hypothesis that