Skip to Content
Merck

EHU133161

MISSION® esiRNA

targeting human NR1H4

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGGACCATGAAGACCAGATTGCTTTGCTGAAAGGGTCTGCGGTTGAAGCTATGTTCCTTCGTTCAGCTGAGATTTTCAATAAGAAACTTCCGTCTGGGCATTCTGACCTATTGGAAGAAAGAATTCGAAATAGTGGTATCTCTGATGAATATATAACACCTATGTTTAGTTTTTATAAAAGTATTGGGGAACTGAAAATGACTCAAGAGGAGTATGCTCTGCTTACAGCAATTGTTATCCTGTCTCCAGATAGACAATACATAAAGGATAGAGAGGCAGTAGAGAAGCTTCAGGAGCCACTTCTTGATGTGCTACAAAAGTTGTGTAAGATTCACCAGCCTGAAAATCCTCAACACTTTGCCTGTCTCCTGGGTCGCCTGACTGAATTACGGACATTCAATCATCACCACGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NR1H4(9971)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Wenxuan Xu et al.
Toxicology and applied pharmacology, 315, 23-34 (2016-12-13)
Alcoholic liver disease (ALD) is a common etiology of liver diseases, characterized by hepatic steatosis. We previously identified farnesoid X receptor (FXR) as a potential therapeutic target for ALD. Dihydroartemisinin (DHA) has been recently identified to possess potent pharmacological activities
Wenxuan Xu et al.
IUBMB life, 68(5), 376-387 (2016-03-31)
Hepatic stellate cells (HSCs) are universally acknowledged to play a stimulative role in the pathogenesis of hepatic fibrosis and portal hypertension. HSCs when activated in response to liver injury are characterized with many changes, with HSC contraction being the most
Ting Fu et al.
Molecular endocrinology (Baltimore, Md.), 30(1), 92-103 (2015-10-28)
The bile acid (BA)-sensing nuclear receptor, farnesoid X receptor (FXR), regulates postprandial metabolic responses, including inhibition of BA synthesis, by inducing the intestinal hormone, fibroblast growth factor (FGF)15 (FGF19 in human). In this study, we tested a novel hypothesis that