Skip to Content
Merck

EHU147391

MISSION® esiRNA

targeting human LIMK2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTAATCCATGGGGAGGTCCTGGGGAAGGGCTTCTTTGGGCAGGCTATCAAGGTGACACACAAAGCCACGGGCAAAGTGATGGTCATGAAAGAGTTAATTCGATGTGATGAGGAGACCCAGAAAACTTTTCTGACTGAGGTGAAAGTGATGCGCAGCCTGGACCACCCCAATGTGCTCAAGTTCATTGGTGTGCTGTACAAGGATAAGAAGCTGAACCTCCTGACAGAGTACATTGAGGGGGGCACACTGAAGGACTTTCTGCGCAGTATGGATCCGTTCCCCTGGCAGCAGAAGGTCAGGTTTGCCAAAGGAATCGCCTCCGGAATGGCCTATTTGCACTCTATGTGCATCATCCACCGGGATCTGAACTCGCACAACTGCCTCATCAAGTTGGACAAGACTGTGGTGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LIMK2(3985)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wei Wang et al.
International journal of cancer, 144(6), 1345-1355 (2018-07-15)
LIM kinases modulate multiple aspects of cancer development, including cell proliferation and survival. As the mechanisms of LIMK-associated tumorigenesis are still unclear, we analyzed the tumorigenic functions of LIM kinase 2 (LIMK2) in human bladder cancer (BC) and explored whether
Xing Duan et al.
Journal of cellular physiology, 233(8), 6088-6097 (2018-01-11)
LIM kinases (LIMK1/2) are LIM domain-containing serine/threonine/tyrosine kinases that mediate multiple cellular processes in mitosis. In the present study, we explored the functional roles and potential signaling pathway of LIMK1/2 during mouse oocyte meiosis. Disruption of LIMK1/2 activity and expression

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service