Skip to Content
Merck

EHU151901

MISSION® esiRNA

targeting human ZEB1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


Quality Level

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGGTGCAAGCTGTTGTTCTGCCAACAGTTGGTTTGGTGTCTCCCATAAGTATCAATTTAAGTGATATTCAGAATGTACTTAAAGTGGCGGTAGATGGTAATGTAATAAGGCAAGTGTTGGAGAATAATCAAGCCAATCTTGCATCCAAAGAACAAGAAACAATCAATGCTTCACCCATACAACAAGGTGGCCATTCTGTTATTTCAGCCATCAGTCTTCCTTTGGTTGATCAAGATGGAACAACCAAAATTATCATCAACTACAGTCTTGAGCAGCCTAGCCAACTTCAAGTTGTTCCTCAAAATTTAAAAAAAGAAAATCCAGTCGCTACAAACAGTTGTAAAAGTGAAAAGTTACCAGAAGATCTTACTGTTAAGTCTGAGAAGGACAAAAGCTTTGAAGGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ZEB1(6935)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ying Jiang et al.
OncoTargets and therapy, 12, 6093-6104 (2019-08-24)
Objective: Gastric cancer (GC) is a common tumor malignancy with high incidence and poor prognosis. Radiotherapy is one of the main strategies for GC treatment, while development of radioresistance limits the effectiveness. microRNA-203 (miR-203) has been reported to participate in
Y-G Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2662-2670 (2018-05-18)
To explore the expression of extracellular vesicle-derived lncZEB1-AS1 in esophageal cancer and its role in esophageal cancer progression. The extracellular vesicles (EVs) from esophageal cancer patients (n = 26) and normal subjects (n = 26) were isolated by differential centrifugation.
Hong-Yan Zhang et al.
Gene, 633, 61-65 (2017-08-28)
The myocardial infarction associated transcript (MIAT), a long non-coding RNA (lncRNA), was originally identified as a candidate gene for myocardial infarction, and was recently shown to participate in the progression of cancer and the process of metastasis. However, the biological