Skip to Content
Merck

EHU157031

MISSION® esiRNA

targeting human NES

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAGGCAGAGCTGAATCTGAGGGAGCAGGATGGCTTCACTGGGAAGGAGGAGGTGGTAGAGCAGGGAGAGCTGAATGCCACAGAGGAGGTCTGGATCCCAGGCGAGGGGCACCCAGAGAGCCCTGAGCCCAAAGAGCAGAGAGGCCTGGTTGAGGGAGCCAGTGTGAAGGGAGGGGCTGAGGGCCTCCAGGACCCTGAAGGGCAATCACAACAGGTGGGGGCCCCAGGCCTCCAGGCTCCCCAGGGGCTGCCAGAGGCGATAGAGCCCCTGGTGGAAGATGATGTGGCCCCAGGGGGTGACCAAGCCTCCCCAGAGGTCATGTTGGGGTCAGAGCCTGCCATGGGTGAGTCTGCTGCGGGAGCTGAGCCAGGCCCGGGGCAGGGGGTGGGAGGGCTGGGGGACCCAGGCCATCTGACCAGGGAAGAGGTGATGGAACCACCCCTGGAAGAGGAGAGTTTGGAGGCAAAGAGGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NES(10763)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Xu Yang et al.
Kidney & blood pressure research, 43(2), 616-627 (2018-04-25)
Preeclampsia (PE) is a pregnancy-specific hypertensive disorder that is characterised by a high incidence of hypertension and proteinuria. Podocytes are involved in the formation of a split membrane, which is the last barrier preventing the leakage of protein into the
Yasuhiro Shinkai et al.
Nucleic acid therapeutics, 27(3), 168-175 (2017-03-30)
Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES
Se Jeong Lee et al.
BMC cancer, 15, 1011-1011 (2015-12-26)
Glioblastoma multiforme (GBM) is characterized by extensive local invasion, which is in contrast with extremely rare systemic metastasis of GBM. Molecular mechanisms inhibiting systemic metastasis of GBM would be a novel therapeutic candidate for GBM in the brain. Patient-derived GBM