Skip to Content
Merck

EMU037461

MISSION® esiRNA

targeting mouse Bcl2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCAAATGCTGGACTGAAAAATTGTAATTCATCTGCCGCCGCCGCCGCTGCCTTTTTGCCCCGCTGCGGTGCTCTTGAGATCTCTGGTTGGGATTCCTACGGATTGACATTCTCAGTGAAGCCGGAGTGTGAGGACCCAATCTGGAAACCCTCCTGATTTTTCCTCCACCTAGCCCCCAGACCCCAACTCCCGATTCATTGCAAGTTGTAAAGAAGCTTATACAAGGAGACTTCTGAAGATCGATGGTGTGGTTGCCTTATGTATTTGTTTGGGTTTTACCAAAAAAGGGTAAACTTGACAGAAGATCATGCCGTCCTTAGAAAATACAGCATTGCGGAGGAAGTAGACTGATATTAACAAAGCTTAATAAATAATGTACCTCATGAAATAAAAAGCAGAAAGGAATTTGAATAAAAATTTCCTGCATCTCATGCCAACGGGGAAACACCAGAATCAAGTGTTCGGTGTAACTAAAGACACCCCTTCATCCAAGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Qingmin Wang et al.
PloS one, 9(7), e100949-e100949 (2014-07-08)
MPT64 is one of the secreted proteins from Mycobacterium tuberculosis. Little is known about its role in infection by Mycobacterium tuberculosis. In this study, we demonstrated that MPT64 could dose-dependently inhibit the apoptosis of RAW264.7 macrophages induced by PPD-BCG. Quantitative
Xi-Mei Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(5), 1914-1926 (2015-11-20)
Dipeptidyl peptidase-4 (DPP-4) inhibitors have pleiotropic effects on cardiovascular protection beyond the antidiabetic property. However, it remains unknown that the impact of one DPP-4 inhibitor sitagliptin on the survival of mesenchymal stem cells (MSCs) in hypoxia and serum deprivation (H/SD)
Yuting Wen et al.
Science advances, 6(31), eabc2148-eabc2148 (2020-08-25)
It requires multistep synthesis and conjugation processes to incorporate multifunctionalities into a polyplex gene vehicle to overcome numerous hurdles during gene delivery. Here, we describe a supramolecular platform to precisely control, screen, and optimize molecular architectures of siRNA targeted delivery