Skip to Content
Merck

EHU044981

MISSION® esiRNA

targeting human SLC7A5

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGGCACCAAACTGGATGTGGGGAACATTGTGCTGGCATTATACAGCGGCCTCTTTGCCTATGGAGGATGGAATTACTTGAATTTCGTCACAGAGGAAATGATCAACCCCTACAGAAACCTGCCCCTGGCCATCATCATCTCCCTGCCCATCGTGACGCTGGTGTACGTGCTGACCAACCTGGCCTACTTCACCACCCTGTCCACCGAGCAGATGCTGTCGTCCGAGGCCGTGGCCGTGGACTTCGGGAACTATCACCTGGGCGTCATGTCCTGGATCATCCCCGTCTTCGTGGGCCTGTCCTGCTTCGGCTCCGTCAATGGGTCCCTGTTCACATCCTCCAGGCTCTTCTTCGTGGGGTCCCGGGAAGGCCACCTGCCCTCCATCCTCTCCATGATCCACCCACAGCTCCTCACCCCCGTGCCGTCCCTCGTGTTCACGTGTGTGATGACGCTGCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Danting Cao et al.
Arteriosclerosis, thrombosis, and vascular biology, 40(5), 1195-1206 (2020-03-28)
MicroRNA-126-3p (miR-126) is required for angiogenesis during organismal development or the repair of injured arterial vasculature. The role of miR-126 in lung microvascular endothelial cells, which are essential for gas exchange and for lung injury repair and regeneration, remains poorly
Ling Wei et al.
Cancer science, 107(3), 347-352 (2016-01-11)
3-(18)F-l-α-methyl-tyrosine ([18F]FAMT), a PET probe for tumor imaging, has advantages of high cancer-specificity and lower physiologic background. FAMT-PET has been proved useful in clinical studies for the prediction of prognosis, the assessment of therapy response and the differentiation of malignant
Yu Takahashi et al.
Pharmaceutical research, 35(12), 246-246 (2018-10-31)
The anti-epileptic drug pregabalin crosses the blood-brain barrier (BBB) in spite of its low lipophilicity. This study was performed to determine whether L-type amino acid transporters (LAT1/SLC7A5 and LAT2/SLC7A8) contribute to the uptake of pregabalin. Pregabalin uptake by LATs-transfected HEK293
Keisuke Enomoto et al.
Scientific reports, 9(1), 14616-14616 (2019-10-12)
A novel therapeutic approach is urgently needed for patients with anaplastic thyroid cancer (ATC) due to its fatal and rapid progress. We recently reported that ATC highly expressed MYC protein and blocking of MYC through its selective inhibitor, JQ1, decreased
Naoya Nakai et al.
Journal of cellular biochemistry, 119(2), 2094-2101 (2017-09-01)
Branched-chain amino acid supplements consumed following exercise are widely used to increase muscle mass. Although both exercise (ie, mechanical stimulation) and branched-chain amino acid leucine supplementation have been reported to stimulate muscle protein synthesis by activating the mammalian target of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service