Skip to Content
Merck

EHU047031

MISSION® esiRNA

targeting human MMP8

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACAATTCATGGAGCCAGGTTATCCCAAAAGCATATCAGGTGCCTTTCCAGGAATAGAGAGTAAAGTTGATGCAGTTTTCCAGCAAGAACATTTCTTCCATGTCTTCAGTGGACCAAGATATTACGCATTTGATCTTATTGCTCAGAGAGTTACCAGAGTTGCAAGAGGCAATAAATGGCTTAACTGTAGATATGGCTGAAGCAAAATCAAATGTGGCTGTATCCACTTTCAGAATGTTGAAGGGAAGTTCAGCAAGCATTTTCGTTACATTGTGTCCTGCTTATACTTTTCTCAATATTAAGTCATTGTTTCCCATCACTGTATCCATTCTACCTGTCCTCCGTGAAAATATGTTTGGAATATTCCACTATTTGCAGAGGCTTATTCAGTTCTTACACATTCCATCTTACATTAGTGATTCCATCAAAGAGAAGGAAAGTAAGCCTTTTTGTCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MMP8(4317)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Alexandra Schubert-Unkmeir et al.
PLoS pathogens, 6(4), e1000874-e1000874 (2010-05-06)
Disruption of the blood-brain barrier (BBB) is a hallmark event in the pathophysiology of bacterial meningitis. Several inflammatory mediators, such as tumor necrosis factor alpha (TNF-alpha), nitric oxide and matrix metalloproteinases (MMPs), contribute to this disruption. Here we show that
Guanmei Wen et al.
The Journal of biological chemistry, 290(31), 19158-19172 (2015-06-21)
Matrix metalloproteinase-8 (MMP8) has been shown to influence various cellular functions. As monocytes and macrophages (Mφ) express MMP8, we investigated if MMP8 played a role in macrophage differentiation and polarization. MMP8 expression was significantly increased during monocyte differentiation into Mφ.
Muge Sarper et al.
Breast cancer research : BCR, 19(1), 33-33 (2017-03-24)
Normal myoepithelial cells (MECs) play an important tumour-suppressor role in the breast but display an altered phenotype in ductal carcinoma in situ (DCIS), gaining tumour-promoter functions. Matrix metalloproteinase-8 (MMP-8) is expressed by normal MECs but is lost in DCIS. This