Skip to Content
Merck

EHU093481

MISSION® esiRNA

targeting human CFLAR

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATGCTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTTCTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTACAGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAGACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATTGGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATGGGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAACTAAATCTGGTTGCCCCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... CFLAR(8837)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Reyaz ur Rasool et al.
Scientific reports, 6, 18800-18800 (2016-01-06)
The eukaryotic translation initiation factor 4E (eIF4E) is considered as a key survival protein involved in cell cycle progression, transformation and apoptosis resistance. Herein, we demonstrate that medicinal plant derivative 3-AWA (from Withaferin A) suppressed the proliferation and metastasis of
H H Cheung et al.
Cell death & disease, 2, e146-e146 (2011-04-15)
Smac mimetic compounds (SMCs) are experimental small molecules that induce tumour necrosis factor alpha (TNFα)-dependent cancer cell death by targeting the inhibitor of apoptosis proteins. However, many cancer cell lines are resistant to SMC-mediated apoptosis despite the presence of TNFα.
Therese Bredholt et al.
Molecular cancer, 8, 101-101 (2009-11-17)
An organic extract of the recreational herb khat (Catha edulis Forsk.) triggers cell death in various leukemia cell lines in vitro. The chemotherapeutics camptothecin, a plant alkaloid topoisomerase I inhibitor, was tested side-by-side with khat in a panel of acute
Andre van Krüchten et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(5), 2779-2793 (2018-02-07)
Superinfections with Staphylococcus aureus are a major complication of influenza disease, causing excessive inflammation and tissue damage. This enhanced cell-damaging effect is also observed in superinfected tissue cultures, leading to a strong decrease in overall cell viability. In our analysis
Tae-Eun Kim et al.
Oncotarget, 8(8), 13957-13970 (2017-01-14)
In this study, we examined the molecular mechanism underlying the resistance of cancer cells to R27T, a glycoengineered version of recombinant human interferon (IFN)-β1a, and sought to overcome R27T resistance through combination therapy. R27T has been shown to induce anti-proliferation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service