Skip to Content
Merck

EHU108601

MISSION® esiRNA

targeting human RBM4, RBM14-RBM4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGATTCGCTCACTCTTCGAGCAGTATGGGAAGGTGCTGGAATGTGACATCATTAAGAATTACGGCTTTGTGCACATAGAAGACAAGACGGCAGCTGAGGATGCCATACGCAACCTGCACCATTACAAGCTTCATGGGGTGAACATCAACGTGGAAGCCAGCAAGAATAAGAGCAAAACCTCAACAAAGTTGCATGTGGGCAACATCAGTCCCACCTGCACCAATAAGGAGCTTCGAGCCAAGTTTGAGGAGTATGGTCCGGTCATCGAATGTGACATCGTGAAAGATTATGCCTTCGTACACATGGAGCGGGCAGAGGATGCAGTGGAGGCCATCAGGGGCCTTGATAACACAGAGTTTCAAGGCAAACGAATGCACGTGCAGTTGTCCACCAGCCGGCTTAGGACTGCGCCCGGGATGGGAGACCAGAGCGGCTGCTATCGGTGCGGGAAAGAGGGGCACTGGTCCAAAGAGTGTCCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... RBM4(5936)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guo-Wei Huang et al.
The international journal of biochemistry & cell biology, 90, 59-67 (2017-07-30)
LncRNAs play a vital role in alternative splicing of target genes. However, the mechanisms underlying lncRNAs involvement in splicing are poorly understood. In the present study, we identified a previously uncharacterized lncRNA, which is denoted as TPM1-AS, is reverse-transcribed from
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear
Sven Hennig et al.
The Journal of cell biology, 210(4), 529-539 (2015-08-19)
Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule assembly. In this paper

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service