Skip to Content
Merck

EHU114351

MISSION® esiRNA

targeting human PTRH2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGACGAGCAAGACACACACAGATACTGAAAGTGAAGCAAGCATCTTGGGAGACAGCGGGGAGTACAAGATGATTCTTGTGGTTCGAAATGACTTAAAGATGGGAAAAGGGAAAGTGGCTGCCCAGTGCTCTCATGCTGCTGTTTCAGCCTACAAGCAGATTCAAAGAAGAAATCCTGAAATGCTCAAACAATGGGAATACTGTGGCCAGCCCAAGGTGGTGGTCAAAGCTCCTGATGAAGAAACCCTGATTGCATTATTGGCCCATGCAAAAATGCTGGGACTGACTGTAAGTTTAATTCAAGATGCTGGACGTACTCAGATTGCACCAGGCTCTCAAACTGTCCTAGGGATTGGGCCAGGACCAGCAGACCTAATTGACAAAGTCACTGGTCACCTAAAACTTTACTAGGTGGACTTTGATATGACAACAACCCCTCCATCACAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yan Liu et al.
Human cell, 32(4), 418-427 (2019-08-02)
Studies have shown that astrocyte plays an important role in the formation of retinal vasculature during development. For our study, we investigated the role of Bcl2 inhibitor of transcription 1 (Bit1) in regulating astrocyte function from developing retina and its
Xin Yao et al.
PloS one, 9(7), e101564-e101564 (2014-07-09)
The mitochondrial Bit1 (Bcl-2 inhibitor of transcription 1) protein is a part of an apoptotic pathway that is uniquely regulated by integrin-mediated attachment. As an anoikis effector, Bit1 is released into the cytoplasm following loss of cell attachment and induces

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service