Skip to Content
Merck

EMU213731

MISSION® esiRNA

targeting mouse Atr

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGAATTTGCTTCTGTCCTTGGTCAACTTGTCTGTACTCTTCACGGCATGTTTTATTTGAGTTCCTCAGTAGAGCCTTGCTTTGAACATATGGACTTGTTCAGTAAGAACCTGAAAGCCACTTCTCAGCATGAATGTTCATCTTCTCAAGTAAAAGCTTCCACTTGCAAGCCATTCCTTTTCCTGCTGACCAAAAATACACCTAGTCCAGTAAAACTTGCTTTCATAGACAATCTACATCATCTTTGTAAGCATCTTGATTTTCAAGAAGATGAAAGAGAGGTAAAAGCAGTTCTTGGGACTTTATTAAATTTGATGGAAGATCCAGACAAGGATGTTAGAATTGCTTTTAGTGGAAATATCAAGTATATATTGGAATCCTTGAACTCTGAAGATGGATTCGTAAAAGAGCTTTTTGTCTTAAGAATGAAGGAAGCATATACTCATGCCCAAATAGCAAGGAATAATGAGCTAAAGGATACTTTGATTCTTACAACAGGGGATATTGGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Amit Kumar et al.
PloS one, 9(6), e100228-e100228 (2014-06-28)
The Kaposi's sarcoma-associated herpesvirus infects the human population and maintains latency stage of viral life cycle in a variety of cell types including cells of epithelial, mesenchymal and endothelial origin. The establishment of latent infection by KSHV requires the expression
Maude Gabriel et al.
BMC cancer, 15, 227-227 (2015-04-18)
Modification of splicing by chemotherapeutic drugs has usually been evaluated on a limited number of pre-mRNAs selected for their recognized or potential importance in cell proliferation or apoptosis. However, the pathways linking splicing alterations to the efficiency of cancer therapy

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service