Skip to Content
Merck

EHU023381

MISSION® esiRNA

targeting human FFAR2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTGGTGCTCTTCTTCATCCCCATGGCAGTCACCATCTTCTGCTACTGGCGTTTTGTGTGGATCATGCTCTCCCAGCCCCTTGTGGGGGCCCAGAGGCGGCGCCGAGCCGTGGGGCTGGCTGTGGTGACGCTGCTCAATTTCCTGGTGTGCTTCGGACCTTACAACGTGTCCCACCTGGTGGGGTATCACCAGAGAAAAAGCCCCTGGTGGCGGTCAATAGCCGTGGTGTTCAGTTCACTCAACGCCAGTCTGGACCCCCTGCTCTTCTATTTCTCTTCTTCAGTGGTGCGCAGGGCATTTGGGAGAGGGCTGCAGGTGCTGCGGAATCAGGGCTCCTCCCTGTTGGGACGCAGAGGCAAAGACACAGCAGAGGGGACAAATGAGGACAGGGGTGTGGGTCAAGGAGAAGGGATGCCAAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FFAR2(2867)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Laure B Bindels et al.
British journal of cancer, 117(9), 1336-1340 (2017-09-06)
Activation of free fatty acid receptor 2 (FFAR2) by microbiota-derived metabolites (e.g., propionate) reduces leukaemic cell proliferation in vitro. This study aims to test whether Ffar2 expression per se also influences leukaemia cell growth in vivo. Bcr-Abl-expressing BaF cells were
Rebecca Roy et al.
Journal of molecular endocrinology, 65(2), 21-34 (2020-06-25)
Gestational diabetes mellitus (GDM) affects up to 16% of pregnant women and is associated with significant long-term health detriments for the mother and her offspring. Two central features of GDM are low-grade inflammation and maternal peripheral insulin resistance, therefore therapeutics
Hiroki Yoshida et al.
Archives of biochemistry and biophysics, 672, 108057-108057 (2019-07-30)
Short-chain fatty acids (SCFAs) such as acetate, propionate, and butyrate are generated by gut microbial fermentation of dietary fiber. SCFAs may exert multiple beneficial effects on human lipid and glucose metabolism. However, their actions and underlying mechanisms are not fully