Skip to Content
Merck

EHU155611

MISSION® esiRNA

targeting human KDR

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGATGGCCTCTTCTGTAAGACACTCACAATTCCAAAAGTGATCGGAAATGACACTGGAGCCTACAAGTGCTTCTACCGGGAAACTGACTTGGCCTCGGTCATTTATGTCTATGTTCAAGATTACAGATCTCCATTTATTGCTTCTGTTAGTGACCAACATGGAGTCGTGTACATTACTGAGAACAAAAACAAAACTGTGGTGATTCCATGTCTCGGGTCCATTTCAAATCTCAACGTGTCACTTTGTGCAAGATACCCAGAAAAGAGATTTGTTCCTGATGGTAACAGAATTTCCTGGGACAGCAAGAAGGGCTTTACTATTCCCAGCTACATGATCAGCTATGCTGGCATGGTCTTCTGTGAAGCAAAAATTAATGATGAAAGTTACCAGTCTATTATGTACATAGTTGTCGTTGTAGGGTATAGGATTTATGATGTGGTTCTGAGTCCGTCTCATGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KDR(3791)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



W-Z Hou et al.
European review for medical and pharmacological sciences, 21(5), 1080-1087 (2017-03-25)
Cerebral aneurysm is a common vascular disease with high morbidity and mortality. Vascular smooth muscle deletion or dysplasia is an important reason for the development of cerebral aneurysm. MiRNAs participate in a variety of biological functions through inhibiting target gene
Evan Bailey et al.
The American journal of pathology, 187(1), 25-32 (2016-11-16)
Vascular endothelial growth factor (VEGF)-D is capable of inducing angiogenesis and lymphangiogenesis through signaling via VEGF receptor (VEGFR)-2 and VEGFR-3, respectively. Mutations in the FIGF (c-fos-induced growth factor) gene encoding VEGF-D have not been reported previously. We describe a young
Chao Ji et al.
Oncotarget, 7(51), 84748-84757 (2016-10-08)
Ultra Violet (UV) radiation induces reactive oxygen species (ROS) production, DNA oxidation and single strand breaks (SSBs), which will eventually lead to skin cell damages or even skin cancer. Here, we tested the potential activity of gremlin, a novel vascular