Skip to Content
Merck

EHU050311

MISSION® esiRNA

targeting human PTGS2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCGGGAACACAACAGAGTATGCGATGTGCTTAAACAGGAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTAATACTGATAGGAGAGACTATTAAGATTGTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAACTGAAATTTGACCCAGAACTACTTTTCAACAAACAATTCCAGTACCAAAATCGTATTGCTGCTGAATTTAACACCCTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCATGACCAGAAATACAACTATCAACAGTTTATCTACAACAACTCTATATTGCTGGAACATGGAATTACCCAGTTTGTTGAATCATTCACCAGGCAAATTGCTGGCAGGGTTGCTGGTGGTAGGAATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTGS2(5743)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ke Liao et al.
Journal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology, 15(3), 390-399 (2019-07-22)
Long non-coding RNAs (lncRNAs), including long intergenic non-coding RNAs (lincRNAs), play an important regulatory role in controlling various biological processes. Both in vitro and in vivo studies have demonstrated that lincRNA-Cox2 plays a global regulatory role in regulating the expression
Mia Madel Alfajaro et al.
PloS one, 13(7), e0200726-e0200726 (2018-07-19)
Cyclooxygenases (COXs)/prostaglandin E2 (PGE2) signaling pathways are known to modulate a variety of homeostatic processes and are involved in various pathophysiological conditions. COXs/PGE2 signaling pathways have also been demonstrated to have proviral or antiviral effects, which appeared different even in
Lei Zhang et al.
Reproduction, fertility, and development (2018-07-10)
Circular RNAs (circRNAs) have been found to play important functional roles in epigenetic regulation under certain physiological and pathological conditions. However, knowledge of circRNAs during the development of receptive endometrium (RE) from pre-RE is limited. In the RE of dairy