Skip to Content
Merck

EHU094011

MISSION® esiRNA

targeting human ITPR1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGACCTGAGGAGTGAGAAGCAGAAGAAGGAAGAGATCTTGAAGACCACGTGCTTTATCTGTGGCTTGGAAAGAGACAAGTTTGACAACAAGACTGTCACCTTTGAAGAGCACATCAAGGAAGAACACAACATGTGGCACTATCTGTGCTTCATCGTCCTGGTGAAAGTAAAGGACTCCACCGAATATACTGGGCCTGAGAGTTACGTGGCAGAAATGATCAAGGAAAGAAACCTTGACTGGTTCCCCAGGATGAGAGCCATGTCATTGGTCAGCAGTGATTCTGAAGGAGAACAGAATGAGCTGAGAAACCTGCAGGAGAAGCTGGAGTCCACCATGAAACTTGTCACGAACCTTTCTGGCCAGCTGTCGGAATTAAAGGATCAGATGACAGAACAAAGGAAGCAGAAACAAAGAATTGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ITPR1(3708)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ting Yu et al.
Experimental cell research, 399(2), 112438-112438 (2020-12-29)
Palmitic acid (PA)-induced hepatocyte apoptosis is critical for the progression of nonalcoholic fatty liver disease (NAFLD). Inositol 1,4,5-trisphosphate receptor type 1 (IP3R1) is an intracellular Ca2+-release channel and is involved in PA-induced hepatocyte apoptosis. While the expression of IP3R1 is
Jie Tong et al.
Biochimica et biophysica acta, 1864(12), 2389-2401 (2017-10-01)
The mechanism by which cell shape regulates the function of the cell is one of the most important biological issues, but it remains unclear. Here, we investigated the effect of the regulation of cell shape on proliferation by using a
Yi-Dong Yang et al.
Journal of cellular biochemistry, 120(11), 18967-18978 (2019-06-27)
Mitochondrial dysfunction plays a principal role in hypoxia-induced endothelial injury, which is involved in hypoxic pulmonary hypertension and ischemic cardiovascular diseases. Recent studies have identified mitochondria-associated membranes (MAMs) that modulate mitochondrial function under a variety of pathophysiological conditions such as high-fat diet-mediated