Skip to Content
Merck

EHU107781

MISSION® esiRNA

targeting human FFAR3

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human FFAR3

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTACAACGTGTCCCATGTCGTGGGCTATATCTGCGGTGAAAGCCCGGCGTGGAGGATCTACGTGACGCTTCTCAGCACCCTGAACTCCTGTGTCGACCCCTTTGTCTACTACTTCTCCTCCTCCGGGTTCCAAGCCGACTTTCATGAGCTGCTGAGGAGGTTGTGTGGGCTCTGGGGCCAGTGGCAGCAGGAGAGCAGCATGGAGCTGAAGGAGCAGAAGGGAGGGGAGGAGCAGAGAGCGGACCGACCAGCTGAAAGAAAGACCAGTGAACACTCACAGGGCTGTGGAACTGGTGGCCAGGTGGCCTGTGCTGAAAGCTAGGTCCTCCGGGGGAGGAGGGTGTAGCTGGCATGTCATCCTCAGGGCGCTTCCTCGCTCACGCCAGGAGGGACTTGGAGTGGCGAGCTGGGGCCCGATGGGGCTTGGGGGCAGAGTAGACATCTAGCCTCCCTAAGGGTATGCGCGCTAAAGCCCAGCTCTCGATCTCACCTCC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hope Eveline Carter Moylan et al.
Molecular human reproduction, 26(6), 452-468 (2020-04-03)
Spontaneous preterm birth is a global health issue affecting up to 20% of pregnancies and leaves a legacy of neurodevelopmental complications. Inflammation has been implicated in a significant proportion of preterm births, where pro-inflammatory insults trigger production of additional pro-inflammatory
Hideo Ohira et al.
Lipids in health and disease, 15(1), 213-213 (2016-12-13)
Interactions between adipocytes and macrophages are associated with metabolic disorders. Production of pro-inflammatory mediators and the release of free fatty acids (FFAs) increase when these cells are co-cultured; butyrate significantly diminishes these effects by suppressing both the macrophage inflammatory and
Rebecca Roy et al.
Journal of molecular endocrinology, 65(2), 21-34 (2020-06-25)
Gestational diabetes mellitus (GDM) affects up to 16% of pregnant women and is associated with significant long-term health detriments for the mother and her offspring. Two central features of GDM are low-grade inflammation and maternal peripheral insulin resistance, therefore therapeutics
Estela Lorza-Gil et al.
Scientific reports, 10(1), 16497-16497 (2020-10-07)
The expression of short chain fatty acid receptors FFA2 and FFA3 in pancreatic islets raised interest in using them as drug targets for treating hyperglycemia in humans. This study aims to examine the efficacy of synthetic FFA2- and FFA3-ligands to
Mamiko Kobayashi et al.
Biochemical and biophysical research communications, 486(2), 499-505 (2017-03-23)
Short-chain fatty acids (SCFAs), such as acetate, propionate, and butyrate, are produced predominantly by gut microbiota fermentation of dietary fiber. SCFAs are newly identified as endogenous ligands of two orphan G protein-coupled receptors, GPR41 and GPR43, which have the potential

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service