Skip to Content
Merck

EHU143271

MISSION® esiRNA

targeting human ILK

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ILK(3611)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Zhen-Hua Liu et al.
Nutrition and cancer, 72(6), 968-975 (2019-10-02)
The change of fatty acid composition has been regarded as an indicator of altered lipid metabolism during human tumourigenesis, but the details are still unclear. We have previously demonstrated a monounsaturated fatty acid (MUFA) named oleic acid (OA) was involved
Maria Louca et al.
Molecular and cellular biochemistry, 471(1-2), 143-153 (2020-06-09)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor and it is associated with poor survival. Integrin-linked kinase (ILK) is a serine/threonine protein pseudo-kinase that binds to the cytoplasmic domains of β1 and β3 integrins and has been
Qiaomei Zheng et al.
Drug design, development and therapy, 14, 3663-3672 (2020-09-29)
To explore the exact mechanism through which emodin down-regulates the migration and invasion abilities of endometrial stromal cells. Moreover, to explore the theoretical basis of emodin in the treatment of endometriosis. Endometriosis endometrial stromal cells (EESs) were cultured from 15