Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGAAGTTTTACGGCTTGCAAGTAACAGGCAAAGCTGATGCAGACACCATGAAGGCCATGAGGCGCCCCCGATGTGGTGTTCCAGACAAGTTTGGGGCTGAGATCAAGGCCAATGTTCGAAGGAAGCGCTACGCCATCCAGGGTCTCAAATGGCAACATAATGAAATCACTTTCTGCATCCAGAATTACACCCCCAAGGTGGGCGAGTATGCCACATACGAGGCCATTCGCAAGGCGTTCCGCGTGTGGGAGAGTGCCACACCACTGCGCTTCCGCGAGGTGCCCTATGCCTACATCCGTGAGGGCCATGAGAAGCAGGCCGACATCATGATCTTCTTTGCCGAGGGCTTCCATGGCGACAGCACGCCCTTCGATGGTGAGGGCGGCTTCCTGGCCCATGCCTACTTCCCAGGCCCCAACATTGGAGGAGACACCCACT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MMP14(4323)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Charles Marusak et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(22), 6039-6050 (2020-08-21)
The extracellular matrix (ECM) is an intriguing, yet understudied component of therapy resistance. Here, we investigated the role of ECM remodeling by the collagenase, MT1-MMP, in conferring resistance of v-Raf murine sarcoma viral oncogene homolog B1 (BRAF)-mutant melanoma to BRAF
Pirita Pekkonen et al.
eLife, 7 (2018-05-02)
Lymphatic invasion and lymph node metastasis correlate with poor clinical outcome in melanoma. However, the mechanisms of lymphatic dissemination in distant metastasis remain incompletely understood. We show here that exposure of expansively growing human WM852 melanoma cells, but not singly
Po-Hsiang Chang et al.
Scientific reports, 8, 45751-45751 (2017-04-04)
Cancer stem cells (CSCs), a small population of cancer cells, have been considered to be the origin of cancer initiation, recurrence, and metastasis. Tumor microenvironment provides crucial signals for CSCs to maintain stem cell properties and promotes tumorigenesis. Therefore, establishment