Skip to Content
Merck

EHU152001

MISSION® esiRNA

targeting human MMP14

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGAAGTTTTACGGCTTGCAAGTAACAGGCAAAGCTGATGCAGACACCATGAAGGCCATGAGGCGCCCCCGATGTGGTGTTCCAGACAAGTTTGGGGCTGAGATCAAGGCCAATGTTCGAAGGAAGCGCTACGCCATCCAGGGTCTCAAATGGCAACATAATGAAATCACTTTCTGCATCCAGAATTACACCCCCAAGGTGGGCGAGTATGCCACATACGAGGCCATTCGCAAGGCGTTCCGCGTGTGGGAGAGTGCCACACCACTGCGCTTCCGCGAGGTGCCCTATGCCTACATCCGTGAGGGCCATGAGAAGCAGGCCGACATCATGATCTTCTTTGCCGAGGGCTTCCATGGCGACAGCACGCCCTTCGATGGTGAGGGCGGCTTCCTGGCCCATGCCTACTTCCCAGGCCCCAACATTGGAGGAGACACCCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MMP14(4323)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Charles Marusak et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(22), 6039-6050 (2020-08-21)
The extracellular matrix (ECM) is an intriguing, yet understudied component of therapy resistance. Here, we investigated the role of ECM remodeling by the collagenase, MT1-MMP, in conferring resistance of v-Raf murine sarcoma viral oncogene homolog B1 (BRAF)-mutant melanoma to BRAF
Pirita Pekkonen et al.
eLife, 7 (2018-05-02)
Lymphatic invasion and lymph node metastasis correlate with poor clinical outcome in melanoma. However, the mechanisms of lymphatic dissemination in distant metastasis remain incompletely understood. We show here that exposure of expansively growing human WM852 melanoma cells, but not singly
Po-Hsiang Chang et al.
Scientific reports, 8, 45751-45751 (2017-04-04)
Cancer stem cells (CSCs), a small population of cancer cells, have been considered to be the origin of cancer initiation, recurrence, and metastasis. Tumor microenvironment provides crucial signals for CSCs to maintain stem cell properties and promotes tumorigenesis. Therefore, establishment