Skip to Content
Merck

EHU153501

MISSION® esiRNA

targeting human RHBDF2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGTGTACGAGAGCGTGAAGTACATCCAGCAGGAGAACTTCTGGGTTGGCCCCAGCTCGATTGACCTGATCCACCTGGGGGCCAAGTTCTCACCCTGCATCCGGAAGGACGGGCAGATCGAGCAGCTGGTGCTGCGCGAGCGAGACCTGGAGCGGGACTCAGGCTGCTGTGTCCAGAATGACCACTCCGGATGCATCCAGACCCAGCGGAAGGACTGCTCGGAGACTTTGGCCACTTTTGTCAAGTGGCAGGATGACACTGGGCCCCCCATGGACAAGTCTGATCTGGGCCAGAAGCGGACTTCGGGGGCTGTCTGCCACCAGGACCCCAGGACCTGCGAGGAGCCAGCCTCCAGCGGTGCCCACATCTGGCCCGATGACATCACTAAGTGGCCGATCTGCACAGAGCAGGCCAGGAGCAACCACACAGGCTTCCTGCACATGGACTGCGAGATCAAGGGCCGCCCCTGCTGCATCGGCACCAAGGGCAGCTGTGAGATCACCACCCGGGAATACTGTGAGTTCATGCACGGCTATTTCCATGAGGAAGCAACACTCTGCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RHBDF2(79651)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Chen-Xu Ge et al.
Biochemical and biophysical research communications, 493(4), 1402-1409 (2017-10-03)
Accumulating researches reported that particulate matter (PM2.5) is a risk factor for developing various diseases, including metabolic syndrome. Recently, inactive rhomboid protein 2 (iRhom2) was considered as a necessary modulator for shedding of tumor necrosis factor-α (TNF-α) in immune cells.
Cheng Chaohui et al.
Biochemical and biophysical research communications, 503(3), 1897-1904 (2018-08-12)
Atherosclerosis is a complex chronic inflammatory disease that is characterized by the formation of lipid-rich plaques on the inner walls of the arteries. Inactive rhomboid protein 2 (iRhom2) was recently determined as a necessary regulator for the shedding of tumor
Ulrike Künzel et al.
eLife, 7 (2018-06-14)
Many intercellular signals are synthesised as transmembrane precursors that are released by proteolytic cleavage ('shedding') from the cell surface. ADAM17, a membrane-tethered metalloprotease, is the primary shedding enzyme responsible for the release of the inflammatory cytokine TNFα and several EGF