Skip to Content
Merck

EMU037541

MISSION® esiRNA

targeting mouse Marcks

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCCCGCATCTTATTAGCAACCAGGGAGATTTCTCCATTTTCCTCTTGTCTACAGTGCGGCTACAAATCTGGGATTTTTTTTTATTACTTCTTTTTTTAAAAAAACTACACTTGGGCTCCTTTTTTGTGCTCGACTTTTCCACCTTTTTCCCTCCTTCCTGCGCTGCTGCTTTTTTGATCTCTTCGACTAAAAATTTTTTATCCGGAGTATTTAATCGGGTCTCTTCTGTCCTCCTCGCCACCCCCACCCCCTCCCTCCGGTGTGTGTGCCGCCGCCGCTGTTGCTGCTGCTGCTGCTCGCCCCGTCGTTACACCAACCGAAGGCTCTTTGTTTCCTCTCTTGGATCTGTTGAGTTTCTTTGTTGAAGAAGCCAGCATGGGTGCCCAGTTCTCCAAGACCGCAGCGAAGGGAGAAGCCACCGCCGAGAGGCCCGGGGAGGCGGCTGTGGCCTCGTCGCCTTCCAAAGCAAATGGGCAGGAGAATGGCCACGTAAAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ching-Hsien Chen et al.
Oncotarget, 6(17), 15194-15208 (2015-05-28)
Accumulating evidence has suggested that myristoylated alanine-rich C-kinase substrate (MARCKS) is critical for regulating multiple pathophysiological processes. However, the molecular mechanism underlying increased phosphorylation of MARCKS at Ser159/163 (phospho-MARCKS) and its functional consequence in neoplastic disease remain to be established.
C-H Chen et al.
Oncogene, 33(28), 3696-3706 (2013-08-21)
Myristoylated Alanine-Rich C Kinase Substrate (MARCKS), a substrate of protein kinase C, is a key regulatory molecule controlling mucus granule secretion by airway epithelial cells as well as directed migration of leukocytes, stem cells and fibroblasts. Phosphorylation of MARKCS may
Dan Yu et al.
Journal of the American Heart Association, 4(10), e002255-e002255 (2015-10-10)
Transcription of the myristoylated alanine-rich C kinase substrate (MARCKS) is upregulated in animal models of intimal hyperplasia. MARCKS knockdown inhibits vascular smooth muscle cell (VSMC) migration in vitro; however, the mechanism is as yet unknown. We sought to elucidate the