Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGGATCTGGAGACTGACCATCAGTACCTCGCTGGTAGCAGTGGGCCATTCCGGGGCAGAGGCCGCCACCCAGGGAAAGGTGTGAAATCTCCGGGGGAGAAGTCACGCTATGAAACCTCACTAAATCTGACCACCAAACGCTTCTTGGAGCTGCTGAGCCGCTCAGCTGACGGTGTCGTTGACCTGAACTGGGCAGCTGAGGTGCTGAAGGTGCAGAAACGGCGCATCTATGACATCACCAATGTCCTGGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAATCATATCCAGTGGCTAGGCAGCCACACCATGGTGGGGATTGGTAAGCGGCTTGAAGGCCTGACCCAGGACCTGCAGCAACTGCAGGAGAGTGAGCAGCAGCTGGATCACCTGATGCACATCTGTACCACACAGCTGCAACTGCTTTCGGAGGACTC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... E2F1(13555), E2f1(13555)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wanghao Chen et al.
Journal of neuro-oncology, 120(1), 43-53 (2014-08-21)
MicroRNAs (miRNAs) have gained much attention due to their critical roles in diverse biological events, including tumorigenesis. In this study, we demonstrate that miR-136 is down-regulated in two cohorts of patients with glioma. Furthermore, the low-level expression of miR-136 is
Xiaolei Jiang et al.
PloS one, 10(6), e0127951-e0127951 (2015-06-04)
The E2F1 transcription factor regulates cell proliferation and apoptosis through the control of a considerable variety of target genes. Previous work has detailed the role of other transcription factors in mediating the specificity of E2F function. Here we identify the
T J Kaitu'u-Lino et al.
Placenta, 36(8), 932-937 (2015-07-07)
Preeclampsia is a serious complication of pregnancy for which there are no efficacious medical treatments. Soluble endoglin is as an anti-angiogenic factor that contributes to the pathogenesis of the disease, however little is known about its molecular regulation in placenta.