Skip to Content
Merck

EMU075181

MISSION® esiRNA

targeting mouse E2f1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGGATCTGGAGACTGACCATCAGTACCTCGCTGGTAGCAGTGGGCCATTCCGGGGCAGAGGCCGCCACCCAGGGAAAGGTGTGAAATCTCCGGGGGAGAAGTCACGCTATGAAACCTCACTAAATCTGACCACCAAACGCTTCTTGGAGCTGCTGAGCCGCTCAGCTGACGGTGTCGTTGACCTGAACTGGGCAGCTGAGGTGCTGAAGGTGCAGAAACGGCGCATCTATGACATCACCAATGTCCTGGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAATCATATCCAGTGGCTAGGCAGCCACACCATGGTGGGGATTGGTAAGCGGCTTGAAGGCCTGACCCAGGACCTGCAGCAACTGCAGGAGAGTGAGCAGCAGCTGGATCACCTGATGCACATCTGTACCACACAGCTGCAACTGCTTTCGGAGGACTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Wanghao Chen et al.
Journal of neuro-oncology, 120(1), 43-53 (2014-08-21)
MicroRNAs (miRNAs) have gained much attention due to their critical roles in diverse biological events, including tumorigenesis. In this study, we demonstrate that miR-136 is down-regulated in two cohorts of patients with glioma. Furthermore, the low-level expression of miR-136 is
Xiaolei Jiang et al.
PloS one, 10(6), e0127951-e0127951 (2015-06-04)
The E2F1 transcription factor regulates cell proliferation and apoptosis through the control of a considerable variety of target genes. Previous work has detailed the role of other transcription factors in mediating the specificity of E2F function. Here we identify the
T J Kaitu'u-Lino et al.
Placenta, 36(8), 932-937 (2015-07-07)
Preeclampsia is a serious complication of pregnancy for which there are no efficacious medical treatments. Soluble endoglin is as an anti-angiogenic factor that contributes to the pathogenesis of the disease, however little is known about its molecular regulation in placenta.