Skip to Content
Merck

EHU080541

MISSION® esiRNA

targeting human TSPO

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTTCACAGAGAAGGCTGTGGTTCCCCTGGGCCTCTACACTGGGCAGCTGGCCCTGAACTGGGCATGGCCCCCCATCTTCTTTGGTGCCCGACAAATGGGCTGGGCCTTGGTGGATCTCCTGCTGGTCAGTGGGGCGGCGGCAGCCACTACCGTGGCCTGGTACCAGGTGAGCCCGCTGGCCGCCCGCCTGCTCTACCCCTACCTGGCCTGGCTGGCCTTCACGACCACACTCAACTACTGCGTATGGCGGGACAACCATGGCTGGCGTGGGGGACGGCGGCTGCCAGAGTGAGTGCCCGGCCCACCAGGGACTGCAGCTGCACCAGCAGGTGCCATCACGCTTGTGATGTGGTGGCCGTCACGCTTTCATGACCACTGGGCCTGCTAGTCTGTCAGGGCCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TSPO(706)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shanfei Ge et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 942-951 (2017-06-18)
Growth Factor Receptor-bound 2 (GRB2) plays a crucial role in regulation of cellular function including proliferation and differentiation, and we previously identified GRB2 as promoting HSCs (HSCs) proliferation. However, the underlying mechanisms that are involving in the regulation of GRB2
Eleonora Da Pozzo et al.
International journal of molecular sciences, 20(18) (2019-09-13)
A key role of the mitochondrial Translocator Protein 18 KDa (TSPO) in neuroinflammation has been recently proposed. However, little is known about TSPO-activated pathways underlying the modulation of reactive microglia. In the present work, the TSPO activation was explored in
Lian-Pan Wu et al.
Acta pharmacologica Sinica, 41(1), 34-46 (2019-09-14)
Abnormal growth of the intimal layer of blood vessels (neointima formation) contributes to the progression of atherosclerosis and in-stent restenosis. Recent evidence shows that the 18-kDa translocator protein (TSPO), a mitochondrial membrane protein, is involved in diverse cardiovascular diseases. In
Vladimir M Milenkovic et al.
International journal of molecular sciences, 20(13) (2019-07-22)
The 18 kDa translocator protein (TSPO) is an evolutionary conserved cholesterol binding protein localized in the outer mitochondrial membrane. It has been implicated in the regulation of various cellular processes including oxidative stress, proliferation, apoptosis, and steroid hormone biosynthesis. Since
Stefanie Bader et al.
Psychoneuroendocrinology, 106, 65-76 (2019-04-08)
The translocator protein 18 kDa (TSPO), initially characterized as peripheral benzodiazepine receptor, is a conserved outer mitochondrial membrane protein, implicated in cholesterol transport thereby affecting steroid hormone biosynthesis, as well as in general mitochondrial function related to bioenergetics, oxidative stress, and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service