Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
Quality Level
description
Powered by Eupheria Biotech
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAGCTTAAGCCACTGAGCAAGGAAGATTTGGGCCTGCACGCCTACAGGTGTGAGGACTGTGGCAAGTGCAAATGTAAGGAGTGCACCTACCCAAGGCCTCTGCCATCAGACTGGATCTGCGACAAGCAGTGCCTTTGCTCGGCCCAGAACGTGATTGACTATGGGACTTGTGTATGCTGTGTGAAAGGTCTCTTCTATCACTGTTCTAATGATGATGAGGACAACTGTGCTGACAACCCATGTTCTTGCAGCCAGTCTCACTGTTGTACACGATGGTCAGCCATGGGTGTCATGTCCCTCTTTTTGCCTTGTTTATGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGGTGTTATGACCGGGTTAACAGGCCTGGTTGCCGCTGTAAAAACTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SPRY2(10253)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jun-Ho Ahn et al.
Biomolecules & therapeutics, 23(4), 320-326 (2015-07-15)
The clinical benefits of oncogenic BRAF inhibitor therapies are limited by the emergence of drug resistance. In this study, we investigated the role of a negative regulator of the MAPK pathway, Spry2, in acquired resistance using BRAF inhibitor-resistant derivatives of
Yan Liu et al.
Molecular medicine reports, 23(5) (2021-03-25)
Age-related cataract (ARC) is the primary cause of blindness worldwide. Abnormal expression of microRNAs (miRNAs/miRs) has been reported to be associated with multiple diseases, including ARC. However, the potential role of miR-124 in ARC remains unclear. The present study used
Evan K Day et al.
Cell reports, 30(10), 3383-3396 (2020-03-12)
SPRY2 is a purported tumor suppressor in certain cancers that promotes tumor growth and resistance to receptor tyrosine kinase inhibitors in glioblastoma. Here, we identify a SPRY2-dependent bypass signaling mechanism in glioblastoma that drives resistance to EGFR and MET inhibition.