Skip to Content
Merck

EHU106441

MISSION® esiRNA

targeting human PTEN

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human PTEN

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAGTGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTTGCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGACCCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ye Wang et al.
OncoTargets and therapy, 13, 1909-1919 (2020-03-19)
Berberine (BBR), a traditional Chinese medicine, has been shown effects on inhibiting cancer development. Autophagy-mediated resistance plays an important role in cancer progression; therefore, regulation of autophagy is a novel therapeutic strategy for cancer treatment. However, effects of BBR on
Lei Dou et al.
Frontiers in oncology, 11, 614035-614035 (2021-03-27)
microRNAs (miRNAs) are of great significance in cancer treatment, which may have a desirable result on the regulation of tumorigenesis, progression, recurrence, and chemo-resistance of ovarian cancer. However, the research on the further potential application of miR-4461 in ovarian cancer
Hu Gao et al.
Reproduction (Cambridge, England) (2019-11-23)
Sertoli cells are indispensable for normal spermatogenesis and increasing evidence has shown that microRNAs (miRNAs) participate in the regulation of Sertoli cell growth. However, the functions and regulatory mechanisms of miRNAs in Sertoli cells of domestic animals have not been
Aram Ghalali et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 127, 110112-110112 (2020-04-16)
Akt kinase regulates several cellular processes, among them growth, proliferation and survival, and has been correlated to neoplastic disease. We report here crosstalk between several Akt regulatory phosphatases that controls the level of the activated form (phosphorylated) of Akt and
Huachao Shen et al.
Neuropathology : official journal of the Japanese Society of Neuropathology, 40(3), 224-231 (2020-02-11)
Neural stem cell (NSC) transplantation has emerged as a promising approach for the treatment of neurological disorders such as cerebral ischemia. As the majority of newly generated cells from exogenous NSCs fail to integrate into the ischemic brain and establish

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service