Skip to Content
Merck

EMU055151

MISSION® esiRNA

targeting mouse Hdac6

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGGTACTTCCCATCGCCTATGAGTTTAACCCAGAACTGGTGCTGATCTCAGCTGGCTTTGATGCTGCACAAGGGGATCCGCTGGGGGGCTGCCAAGTAACACCGGAAGGTTATGCCCACCTCACCCACCTACTGATGGGCCTTGCTGGTGGCCGTATTATTCTTATTCTAGAGGGTGGATACAATTTGGCATCTATCTCTGAGTCTATGGCTGCCTGCACCCATTCCCTCCTTGGAGACCCACCACCCCAGCTTACTTTGCTGCGACCGCCACAGTCAGGAGCCCTGGTTTCAATCAGTGAGGTCATCCAAGTCCATCGCAAATACTGGCGCAGTTTGCGGTTGAGTAAAATGGAAGACAAGGAAGAATGCTCTAGTTCTAGGCTTGTCGTCAAGAAGTTGCCCCCAACAGCCAGTCCTGTATCAGCTAAGGAAATGACCACACCGAAAGGAAAGGTTCCTGAAGAAAGCGTGAGGAAGACCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Smita Salian-Mehta et al.
The Journal of biological chemistry, 290(22), 14045-14056 (2015-04-16)
The impact of histone deacetylases (HDACs) in the control of gonadotropin releasing hormone (GnRH) neuronal development is unknown. We identified an increase in many HDACs in GT1-7 (differentiated) compared with NLT (undifferentiated) GnRH neuronal cell lines. Increased HDAC9 mRNA and
Regina Kanski et al.
Journal of cell science, 127(Pt 20), 4368-4380 (2014-08-17)
Glial fibrillary acidic protein (GFAP) is the main intermediate filament in astrocytes and is regulated by epigenetic mechanisms during development. We demonstrate that histone acetylation also controls GFAP expression in mature astrocytes. Inhibition of histone deacetylases (HDACs) with trichostatin A
Yixuan Li et al.
Molecular and cellular biology, 35(20), 3547-3565 (2015-08-05)
Histone deacetylase (HDAC) inhibition leads to cell cycle arrest in G1 and G2, suggesting HDACs as therapeutic targets for cancer and diseases linked to abnormal cell growth and proliferation. Many HDACs are transcriptional repressors. Some may alter cell cycle progression