Skip to Content
Merck

EMU175361

MISSION® esiRNA

targeting mouse Dctn4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCCTTCATGAATGTAAGACTTCTAGTTCTGTATGAAGTGAGGCCATTTTGATTGTAAGCCATAGAAGTTCAGCAAGTAGCCAGGATGCCAGCCTAACTCTAGACTTGCTGTTGTTCTCAGATACTAACATTGAGTTGCAAACCTTAATTTCTGCGACGTGTTCTGCTGCACTTTTCCTTAAAGTACTCCTAGTATGTGGCCAGCAGACCTTGGAAGAGAACGCTCCTGCTTACAAACCCTGCTTTGGTTTTCATTTTAAGTCTGCGGAGTTTTGTTTTGTATTAAGGAATGTATAGACTGTACTACAGATAGAAAATAGTCTTTGTTTGTTCTACTTAAGAGAAACCGCTTAGGAAGCTATTGAAAGACACTTTGTTCTTTAAAGATCTTAAGATCAAGCCAATTTCATGAAACAATATTCCCAGAGAGTAATATATGTACTAGAGTAAAGAAGAAAATACTGACCTAATACAACGAGAACAATAATGTCTGCCTCTTAGAAGCTGGAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Leticia M Ignacio-Souza et al.
Endocrinology, 155(8), 2831-2844 (2014-06-04)
In both human and experimental obesity, inflammatory damage to the hypothalamus plays an important role in the loss of the coordinated control of food intake and energy expenditure. Upon prolonged maintenance of increased body mass, the brain changes the defended
Kaori Kojima et al.
Neuroscience letters, 581, 37-41 (2014-08-26)
p62, which is also called sequestosome 1 (SQSTM1), plays a critical role in neuronal cell death. However, the role of p62 in axonal degeneration remains unclear. We evaluated whether the modulation of p62 expression may affect axonal loss in tumor
Young-Ok Son et al.
The Journal of biological chemistry, 290(45), 27090-27100 (2015-09-20)
Arsenic (As(3+)) is a carcinogen with considerable environmental and occupational relevancy. The present study shows that As(3+)-transformed human lung bronchial epithelial BEAS-2B cells (AsT cells) exhibit the property of apoptosis resistance. The level of basal reactive oxygen species (ROS) is
Young-Ok Son et al.
The Journal of biological chemistry, 289(41), 28660-28675 (2014-08-27)
The cadmium-transformed human lung bronchial epithelial BEAS-2B cells exhibit a property of apoptosis resistance as compared with normal non-transformed BEAS-2B cells. The level of basal reactive oxygen species (ROS) is extremely low in transformed cells in correlation with elevated expressions
Ashwani Khurana et al.
Oncotarget, 6(34), 36354-36369 (2015-10-27)
A promising new strategy for cancer therapy is to target the autophagic pathway. In the current study, we demonstrate that the antimalarial drug Quinacrine (QC) reduces cell viability and promotes chemotherapy-induced cell death in an autophagy-dependent manner more extensively in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service