Skip to Content
Merck

EHU092581

MISSION® esiRNA

targeting human ATG7

Sign In to View Organizational & Contract Pricing.

Select a Size

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGTCAAACAGAAGGAGTCACAGCTCTTCCTTACTTCTTAATCAAGTATGATGAGAACATGGTGCTGGTTTCCTTGCTTAAACACTACAGTGATTTCTTCCAAGGTCAAAGGACGAAGATAACAATTGGTGTATATGATCCCTGTAACTTAGCCCAGTACCCTGGATGGCCTTTGAGGAATTTTTTGGTCCTAGCAGCCCACAGATGGAGTAGCAGTTTCCAGTCTGTTGAAGTTGTTTGCTTCCGTGACCGTACCATGCAGGGGGCGAGAGACGTTGCCCACAGCATCATCTTCGAAGTGAAGCTTCCAGAAATGGCATTTAGCCCAGATTGTCCTAAAGCAGTTGGATGGGAAAAGAACCAGAAAGGAGGCATGGGACCAAGGATGGTGAACCTCAG

Ensembl | human accession no.

ENSG00000197548

NCBI accession no.

NM_006395

shipped in

ambient

storage temp.

−20°C

Quality Level

100

Gene Information

human ... ATG7(10533)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
KCV
XZU
ZYU
KXU
OWU

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhuhui Qiao et al.
Cell death discovery, 6, 31-31 (2020-05-08)
Autophagy is a process involving the self-digestion of components that participates in anti-oxidative stress responses and protects cells against oxidative damage. However, the role of autophagy in the anti-oxidative stress responses of melanocytes remains unclear. To investigate the role of
Chao Zhang et al.
Journal of experimental & clinical cancer research : CR, 36(1), 162-162 (2017-11-18)
Glioblastoma multiforme (GBM) is characterized by lethal aggressiveness and patients with GBM are in urgent need for new therapeutic avenues to improve quality of life. Current studies on tumor invasion focused on roles of cytokines in tumor microenvironment and numerous
Tetsuya Saito et al.
Nature communications, 10(1), 1567-1567 (2019-04-07)
Selective autophagy ensures the removal of specific soluble proteins, protein aggregates, damaged mitochondria, and invasive bacteria from cells. Defective autophagy has been directly linked to metabolic disorders. However how selective autophagy regulates metabolism remains largely uncharacterized. Here we show that
Hai-Yan Zhu et al.
Biochemical and biophysical research communications, 516(4), 1265-1271 (2019-07-16)
Leukemia remains a fatal disease for most patients and effective therapeutic strategies are urgently required. Typhaneoside (TYP) is a major flavonoid in the extract of Pollen Typhae, showing significant biological and pharmacological effects. In the present study, we explored the
Paul Zarogoulidis et al.
Molecular oncology, 10(10), 1516-1531 (2016-10-04)
Chemoresistance is a major challenge in lung cancer treatment. Recent findings have revealed that autophagic mechanism contributes significantly to immunosuppressive related chemoresistance. For that reason, targeting autophagy-related immunosuppression is an important approach to reverse tumor drug resistance. In this study
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service