Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGGAGTCCTTGGCTTTGAACTCACACATTACAGGACATATCACAGGCATGGCTAGTGCCTTCAGGACGGTATATCAAGTAGGTGGGGTGACCGCCTATTTCCGAGGGGTGCAGGCCAGAGTAATTTACCAGATCCCCTCCACAGCCATCGCATGGTCTGTGTATGAGTTCTTCAAATACCTAATCACTAAAAGGCAAGAAGAGTGGAGGGCTGGCAAGTGAAGTAGCACTGAACGAAGCCAGGGGTTCAGATGACACTGCTGCATCCTGGTCACATTCTCTGTCTCCTGGAATGCTCCCACCTCAAGTGGAGTTAGAAGGAAGGTAGAGGGGCTCTCCCCCAGGATTTTGGTGTTTTGACTAACACCAGTTCCTGCCAACCTCTGTTGCCACCACCTTTCCTTCCAGGCCCTAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SLC25A28(81894)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2
Zili Zhang et al.
Redox biology, 36, 101619-101619 (2020-08-31)
Ferroptosis is a recently discovered form of programmed cell death, but its regulatory mechanisms are not fully understood. In the current study, we reported that the BRD7-P53-SLC25A28 axis played a crucial role in regulating ferroptosis in hepatic stellate cells (HSCs).
Chunlei Wang et al.
European journal of medical research, 19, 49-49 (2014-09-27)
Among glioma treatment strategies, arsenic trioxide (As2O3) has shown efficacy as a therapeutic agent against human gliomas. However, the exact antitumor mechanism of action of As2O3 is still unclear. Mitochondria are considered to be the major source of intracellular reactive