Skip to Content
Merck

EHU089521

MISSION® esiRNA

targeting human ATM

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGCCTTCTTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATM(472)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongbo Chen et al.
Oncotarget, 7(50), 83241-83257 (2016-11-10)
PICT-1 is an essential ribosome biogenesis factor whose loss induces p53 accumulation and apoptosis. Here, we show that DNA damage changes PICT-1 localization and decreases PICT-1 protein levels via the proteasome pathway. Two important phosphatidylinositol 3-kinase-like kinases (PIKKs), ataxia-telangiectasia mutated
Jung-Hee Lee et al.
Nature communications, 8(1), 903-903 (2017-10-14)
MDC1 plays a critical role in the DNA damage response (DDR) by interacting directly with several factors including γ-H2AX. However, the mechanism by which MDC1 is recruited to damaged sites remains elusive. Here, we show that MDC1 interacts with a
Vinod Vijay Subhash et al.
Molecular cancer therapeutics, 15(12), 3087-3096 (2016-09-18)
Identification of synthetically lethal cellular targets and synergistic drug combinations is important in cancer chemotherapy as they help to overcome treatment resistance and increase efficacy. The Ataxia Telangiectasia Mutated (ATM) kinase is a nuclear protein that plays a major role
Wioleta Grabowska et al.
Biogerontology, 20(6), 783-798 (2019-08-03)
Curcumin, a phytochemical present in the spice named turmeric, and one of the promising anti-aging factors, is itself able to induce cellular senescence. We have recently shown that cells building the vasculature senesced as a result of curcumin treatment. Curcumin-induced
Jing-Hong Chen et al.
Autophagy, 11(2), 239-252 (2015-02-24)
PTEN (phosphatase and tensin homolog), a tumor suppressor frequently mutated in human cancer, has various cytoplasmic and nuclear functions. PTEN translocates to the nucleus from the cytoplasm in response to oxidative stress. However, the mechanism and function of the translocation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service