Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCTGTGCTTTGTGGAAGACCCTACTTTCGGATATGAGGACTTCACTCGGAGAGGGGCTCAGGCACCCCCTACCTTCCGGGCCCAGGATTATACCTGGGAAGACCATGGCTACTCGCTGATCCAGCGGCTTTACCCTGAGGGTGGGCAGCTGCTGGATGAGAAGTTCCAGGCAGCCTATAGCCTCACCTACAATACCATCGCCATGCACAGTGGTGTGGACACCTCCGTGCTCCGCAGGGCCATCTGGAACTATATCCACTGCGTCTTTGGCATCAGATATGATGACTATGATTATGGGGAGGTGAACCAGCTCCTGGAGCGGAACCTCAAGGTCTATATCAAGACAGTGGCCTGCTACCCAGAGAAGACCACCCGAAGAATGTACAACCTCTTCTGGAGGCACTTCCGCCACTCAGAGAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SESN2(83667)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Biochem/physiol Actions
SESN2 (sestrin-2) is a downstream effector of p53. It is associated with cell survival, protection and regeneration. It also plays an important role in autophagy induction and tumor suppression. Overexpression of SENS2 suppresses cancer growth. It controls cell growth and proliferation by suppressing mTORC1 (mammalian target of rapamycin complex 1) activity through an AMPK (5′ AMP-activated protein kinase)-associated mechanism. It is an antioxidant protein, and can be induced by oxidative and energetic stress.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
An ShRNA Based Genetic Screen Identified Sesn2 as a Potential Tumor Suppressor in Lung Cancer via Suppression of Akt-mTOR-p70S6K Signaling.
Xu H
PLoS ONE, 10, e0124033-e0124033 (2015)
Sestrin2: A Promising Therapeutic Target for Liver Diseases.
Kim KM
Biological & Pharmaceutical Bulletin, 38, 966-966 (2015)
SESN2 correlates with advantageous prognosis in hepatocellular carcinoma.
Chen S
Diagnostic Pathology, 12, 13-13 (2017)