Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCCAGAAAGTGAGGGTGGACCCACACTCCCTGGGGTGGGACCAAACTATAATTCCCCAAGGGCTGGTGGCTTCCAAGGGAGTGGGACCCCTGAGCCAGGGTCAGAGACCCTGAAATTGCAGCAGTTGGTGGAGAACATTGACAAGGCCACCACTGATCCCAACGAATGTCTCATTTGCCACCGAGTCTTAAGCTGTCAGAGCTCCCTCAAGATGCATTATCGCACCCACACCGGGGAGAGACCGTTCCAGTGTAAGATCTGTGGCCGAGCCTTTTCTACCAAAGGTAACCTGAAGACACACCTTGGGGTTCACCGAACCAACACATCCATTAAGACGCAGCATTCGTGCCCCATCTGCCAGAAGAAGTTCACTAATGCCGTGATGCTGCAGCAACATATTCGGATGCACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SALL4(57167)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Dengfeng Zhang et al.
Oncology research, 25(5), 763-771 (2016-12-17)
Sal-like protein 4 (SALL4) is a zinc finger transcription factor that has been reported to be aberrantly expressed in several human malignancies and identified as an oncogene. However, the potential role of SALL4 in osteosarcoma remains to be elucidated. In
AmirReza Hesari et al.
Journal of cellular biochemistry (2019-02-17)
Colorectal cancer (CRC) is known as the third most common malignancies among men and women and is also the second leading cause of cancer-related deaths worldwide. It has been indicated that a variety of risk factors are involved in the
Amireza Hesari et al.
Journal of cellular biochemistry, 120(6), 9392-9399 (2018-12-07)
Breast cancer is the most prevalent cancers worldwide and causes a significant amount of deaths annually. Spalt-like transcription factor 4 is known as a transcription factor, which has an important role in the proliferation of cancerous cells. Small interfering RNA