Saltar al contenido
Merck

EHU037241

MISSION® esiRNA

targeting human SMAD3

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCTTTGAGGCTGTCTACCAGTTGACCCGAATGTGCACCATCCGCATGAGCTTCGTCAAAGGCTGGGGAGCGGAGTACAGGAGACAGACTGTGACCAGTACCCCCTGCTGGATTGAGCTGCACCTGAATGGGCCTTTGCAGTGGCTTGACAAGGTCCTCACCCAGATGGGCTCCCCAAGCATCCGCTGTTCCAGTGTGTCTTAGAGACATCAAGTATGGTAGGGGAGGGCAGGCTTGGGGAAAATGGCCATGCAGGAGGTGGAGAAAATTGGAACTCTACTCAACCCATTGTTGTCAAGGAAGAAGAAATCTTTCTCCCTCAACTGAAGGGGTGCACCCACCTGTTTTCTGAAACACACGAGCAAACCCAGAGGTGGATGTTATGAACAGCTGTGTCTGCCAAACACATTTACCCTTTGGCCCCACTTTGAAGGGCAAGAAATGGCGTCTGCTCTGGTGGCTTAAGTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SMAD3(4088)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



S Muppala et al.
Oncogene, 36(36), 5189-5198 (2017-05-10)
TGF-β is a multifunctional cytokine affecting many cell types and implicated in tissue remodeling processes. Due to its many functions and cell-specific effects, the consequences of TGF-β signaling are process-and stage-dependent, and it is not uncommon that TGF-β exerts distinct
Zheng Jiang et al.
Journal of biochemistry, 165(4), 317-322 (2018-12-12)
Radiotherapy is the major treatment modality for malignant glioma. However, the treatment response of radiotherapy is suboptimal due to resistance. Here we aimed to explore the effect and mechanism of Mothers against decapentaplegic homologue (SMAD3) silencing in sensitizing malignant glioma
Ayesha Ghayur et al.
American journal of physiology. Renal physiology, 317(1), F152-F162 (2019-05-30)
Glomerulonephritis (GN) is a common cause of end-stage kidney disease and is characterized by glomerular inflammation, hematuria, proteinuria, and progressive renal dysfunction. Transforming growth factor (TGF)-β is involved in glomerulosclerosis and interstitial fibrosis. TGF-β activates multiple signaling pathways, including the