Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCTGACATGCCTGTACCTCTCCTACTCCTACATGGGCAACGAGATCTCCTACCCGCTCAAGCCCTTCCTGGTGGAGAGCTGCAAGGAGGCCTTTTGGGACCGTTGCCTCTCTGTCATCAACCTCATGAGCTCAAAGATGCTGCAGATAAATGCCGACCCACACTACTTCACACAGGTCTTCTCCGACCTGAAGAACGAGAGCGGCCAGGAGGACAAGAAGCGGCTCCTCCTAGGCCTGGATCGGTGAGCACTGTAGCCTGCGTCATGGCTCAAGGATTCAATGCATTTTTAAGAATTTATTATTAAATCAGTTTTGTGTACAGTATGTGTCTAGCAAAGCCACCAAGGGCCTCACCTTTCCCACAGTCTCTCCCTGGGGTTTTTTTCATCCCTGCCAAGAAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CDK5R1(8851)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Tianmei Qian et al.
Molecular and cellular biochemistry, 447(1-2), 209-215 (2018-02-02)
The proliferation and migration of Schwann cells are critical for the repair and regeneration of injured peripheral nerves. Noncoding RNAs, especially microRNAs (miRNAs), have been demonstrated to participate in regulating the biological behaviors of Schwann cells. Numerous differentially expressed novel
Silvia Moncini et al.
PloS one, 6(5), e20038-e20038 (2011-06-01)
CDK5R1 encodes p35, a specific activator of the serine/threonine kinase CDK5, which plays crucial roles in CNS development and maintenance. CDK5 activity strongly depends on p35 levels and p35/CDK5 misregulation is deleterious for correct CNS function, suggesting that a tightly