Saltar al contenido
Merck

EHU069421

MISSION® esiRNA

targeting human BAX

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGGGAGGCACCCGAGCTGGCCCTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGCATCGGGGACGAACTGGACAGTAACATGGAGCTGCAGAGGATGATTGCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTGGTGCTCAAGGCTGGCGTGAAATGGCGTGATCTGGGCTCACTGCAACCTCTGCCTCCTGGGTTCAAGCGATTCACCTGCCTCAGCATCCCAAGGAGCTGGGATTACAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACATTGGACTTCCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BAX(581)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Li-han Zhang et al.
Apoptosis : an international journal on programmed cell death, 21(4), 473-488 (2016-01-16)
Epirubicin (EPI) is widely used for triple negative breast cancer (TNBC), but a substantial number of patients develop EPI resistance that is associated with poor outcome. The underlying mechanism for EPI resistance remains poorly understood. We have developed and characterized
Chia-Hui Huang et al.
Toxicology and applied pharmacology, 334, 35-46 (2017-09-05)
Quinacrine, which is clinically used as an antimalarial drug, has anti-cancer activity. However, mechanism underlying its cytotoxic effect remains to be completely elucidated. In the present study, we investigated the cytotoxic effect of quinacrine on human leukemia U937 cells. Quinacrine-induced
Ilaria Penna et al.
Oncotarget, 7(4), 3947-3965 (2015-12-19)
Intrinsic cross-resistance to inhibition of different signaling pathways may hamper development of combinatorial treatments in melanoma, but the relative frequency of this phenotype and the strategies to overcome this hurdle remain poorly understood. Among 49 BRAF-mutant melanoma cell lines from