Saltar al contenido
Merck

EHU073951

MISSION® esiRNA

targeting human PAK4

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño


Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGAGTATCCCATGAGCAGTTCCGGGCTGCCCTGCAGCTGGTGGTGGACCCAGGCGACCCCCGCTCCTACCTGGACAACTTCATCAAGATTGGCGAGGGCTCCACGGGCATCGTGTGCATCGCCACCGTGCGCAGCTCGGGCAAGCTGGTGGCCGTCAAGAAGATGGACCTGCGCAAGCAGCAGAGGCGCGAGCTGCTCTTCAACGAGGTGGTAATCATGAGGGACTACCAGCACGAGAATGTGGTGGAGATGTACAACAGCTACCTGGTGGGGGACGAGCTCTGGGTGGTCATGGAGTTCCTGGAAGGAGGCGCCCTCACCGACATCGTCACCCACACCAGGATGAACGAGGAGCAGATCGCGGCCGTGTGCCTTGCAGTGCTGCAGGCCCTGTCGGTGCTCCACGCCCAGGGCGTCATCCACCGGGACATCAAGAGCGACTCGATCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... PAK4(10298)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xianghe Lu et al.
Oncology reports, 38(2), 1240-1250 (2017-07-06)
Glioma is an extremely aggressive and lethal type of brain tumour that originates from glial cells. MicroRNA (miRNA) dysregulation has been implicated in the occurrence and progression of many human cancers, including glioma. Thus, some specific miRNAs are potential therapeutic
Shi-Xun Lu et al.
Cancer letters, 402, 71-80 (2017-06-05)
The dysregulation of transcription factors contributes to the unlimited growth of cancer cells. Zic2 has been shown to be crucial to the progression of human cancers. However, its role in hepatocellular carcinoma (HCC) remains unclear. Our data showed that Zic2
Helen King et al.
Scientific reports, 7, 42575-42575 (2017-02-17)
It has been reported that p21-activated kinase 4 (PAK4) is amplified in pancreatic cancer tissue. PAK4 is a member of the PAK family of serine/threonine kinases, which act as effectors for several small GTPases, and has been specifically identified to
Amro Aboukameel et al.
Molecular cancer therapeutics, 16(1), 76-87 (2017-01-08)
The p21-activated kinase 4 (PAK4) is a key downstream effector of the Rho family GTPases and is found to be overexpressed in pancreatic ductal adenocarcinoma (PDAC) cells but not in normal human pancreatic ductal epithelia (HPDE). Gene copy number amplification
Lizhou Xu et al.
Biomaterials, 264, 120369-120369 (2020-09-26)
With a dismal survival rate, pancreatic cancer (PC) remains one of the most aggressive and devastating malignancies, predominantly due to the absence of a valid biomarker for diagnosis and limited therapeutic options for advanced diseases. Exosomes (Exo) as cell-derived vesicles

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico